TABLE 1.

Primers used for EMSA

ProbeaPrimera Probe size (bp)
phhA GG GGTACC GACCAGCAGGTTGAGGATGTC 321
AA CTGCAG GGGTCTTTGTTGTTGTCGTTGC
CAGCTCGACGAGATCAACAGGG510
CAGGCGCTTGAGGTCGGGCAG
hpd CCGTCGCGGAGTAAAGACGCAG 266
GCCGGCGACATGGGAGATGCC
GGAAGGCATCGGCGGTTCGC500
CGAGCGGCTCGCCATGCCCG
dhcA GCCACGGCGAGGAAGGCGC 130
GCAGTCTGACTGCCGGGTCG
GATTCCCGAGAACCTGATCGCG513
GTCGGGTCCAGTTCGCCGGG
hmgA CTCGCGCCCCAGCGAGTAATG 352
GGACCTGGCACGCTGGCTGC
CAGTACCTGGCCAACCGCTCG498
GGTCAGCACGGTGAAGATCGAC
  • a Primers used to amplify promoter probes for EMSA are shown in bold; primers used as nonspecific competitor probes from intragenic regions are shown in plain text. Primers used to amplify the phhA promoter contained recognition sites for restriction endonucleases (underlined).