TABLE 1.

PCR primers and formulae used to determine V. cholerae VNTR repeat numbers

LocusDye-primerExpected rangea (bp)Formulab
VC0147Tetc-ACGTGCAGGTTCAACCGTG186-224(x − 150)/6
TTGTCATGGCTTGGATTTGG
VC0437Tet-GTTGCCGCCATCACCAGCTTG265-301(x − 245)/6
CGTTAGCATCGAAACTGCTG
VC1650Tet-CCGCTAACTGAGTGACCGC370-440(x − 307)/9
CTACCAAGCGGCGGTTAAGCTG
VCA0171Famd-AGGCGCCTGATGACGAATCC316-442(x − 270)/6
GCTGAAGCCTTTCGCGATCC
VCA0283Fam-GGAGGTAGCTACGAATTCTAC118-244(x − 95)/6
GTACATTCACAATTTGCTCACC
  • a The expected range of the sizes of the fragments produced by amplification using the primers is shown.

  • b In each formula, x is the size of the fragment for each individual isolate and locus pair. Genemapper v4.0 produces sizes in hundredths of a base pair. When the formulas are applied, the value is rounded to the nearest whole number to determine the number of repeats.

  • c Tet, 6-tetamidite.

  • d Fam, 6-carboxyfluorescein.