TABLE 2.

Oligonucleotides used in this study

Primer name and purposeSequencea
Northern hybridization
    TM0227 yhcY-probe fwdGAGTTGCTGAGTCTGACAAACC
    TM0294 yhcY-probe-T7-revCTAATACGACTCACTATAGGGAGATCGTGAAGCTCCTGAGCGAGGC
    TM0360 liaIH-probe fwdTTTGGAGGAGGAAGCTTCG
    TM0361 liaIH-probe-T7-revCTAATACGACTCACTATAGGGAGAGATAGGCAATCGTGTGCTG
    TM0758 ydhE-probe-fwdAGCAACGGTCCATCTTCAC
    TM0759 ydhE-probe-T7-revCTAATACGACTCACTATAGGGAGACTCTCTTTGGAAAGCTCGGC
Overexpression of LiaH
    TM0118 liaH-fwd (XhoI)ATATCTCGAGATGGTATTAAAAAGAATCAGAGACATG
    TM0120 liaH-rev (BamHI)AGCCGGATCCTTATTCATTTGCCGCTTTTGTCTGG
Overexpression of LiaR
    TM1045 liaR-fwd (NdeI)TCGTCATATGGTGATTCGAGTATTATTGATTGATGATC
    TM0124 liaR-rev (BamHI)AGCCGGATCCCTAATTCACGAGATGATTTCGG
Check primers
    TM0151 T7-fwdTAATACGACTCACTATAGGG
    TM0152 T7-revGCTAGTTATTGCTCAGCGG
LFH-PCR and clean deletions
    1315 pspA-up fwdGGACGCTGTACATGTCGATACCTC
    1316 pspA-up rev (cat)CTTGATAATAAGGGTAACTATTGCCGGCTAATTCGGTAACCCTTG
    1317 pspA-do fwd (cat)GGGTAACTAGCCTCGCCGGTCCACGCATACATAGGAGGCCGCAGC
    1318 pspA-do revCCGTTCATCGCAAAGATATGCTCCGC
    TM0457 liaF-upfwd (BamHI)AGCCGGATCCAAGGATTTGCGGTCAAGTCC
    TM0458 liaF-dorev (NcoI)AGCTCCATGGTTCAAGCCGTATGAGGAGGC
    TM0574 liaFclean-uprev (XhoI)GACTCTCGAGTCCTGGTGTCCGCCTCCTTTC
    TM0575 liaFclean-dofwd (XhoI)GACTCTCGAGCGGTGATGTGGATGTGAAGTACG
    TM1055 PliaI-liaIHclean-dofwdCCAGACAAAAGCGGCAAATG
    TM1056 PliaI-liaIHclean-uprevCATTTGCCGCTTTTGTCTGGCTCGCACCGGACCCATTGGC
    TM1057 PliaI-liaIH-upfwd (BamHI)AGCCGGATCCGCGGGCTTCTCTCCGCTGTG
    TM1058 PliaI-liaIH-dorev (EcoRI)CCATGAATTCGAATGCGGACGTCCGTCACGC
    TM1184 liaR-fwd (Term.-up-BamHI)ACGTGGATCCGGACGGCAGCGAAGGTGTTCGG
    TM1185 liaR-rev (Term.-do-SmaI)AGCTCCCGGGAAAAAAAAGCCGTTTCAGGGAAAGGGCTTTTTTTTCTAATTCACGAGATGATTTCGG
    TM1186 gerAC-rev (Term.-up-SmaI)AGCTCCCGGGCTATTTGTTTGCGCCTTTCG
    TM1187 gerAC-fwd (Term.-do-NcoI)ACGTCCATGGGGAGGGCTCTTCATCTGATCCG
Analysis of the ydhE promoter
    TM0480 PydhE-rev (BamHI)CGATGGATCCATCCCGGTGAAGATGGACCG
    TM0481 PydhE-fwd (EcoRI)CGATGAATTCGCGAATGTGACAGCTGAGGG
    TM0682 PydhE-57-fwd (EcoRI)CGATGAATTCAATAGTTCATTCATTTGTACCT
    TM0683 PydhE-34-fwd (EcoRI)CGATGAATTCTGCATGGGTTGTGTTCCCA
    TM1395 PydhE-74-fwd (EcoRI)CCATGAATTCTAAGTCCAGAGCAGCAGAATAG
    TM1559 PydhE-96-fwd (EcoRI)ATCGGAATTCGCTTGGGTGTCTTTTTTTTG
    TM1583 PydhE-71-fwd (EcoRI)ATCGGAATTCGTCCAGAGCAGCAGAATAGTTC
Gel mobility shift assay
    TM0632 bceA-fwdGAAGTGCTGAAGGGCATCG
    TM0633 bceA-revCATAGCCGTCATGTCATTTCC
    TM0099 PliaI-fwd (EcoRI)CCATGAATTCCCGGTGCGAGATACGACTCC
    TM0100 PliaI-rev (BamHI)CGATGGATCCTCCTCCAAAAAAGACGGAGATCCC
    TM1490 PydhE-fwd (EcoRI)CCATGAATTCAGACACCAGAGCTTGGGTGTC
    TM0480 PydhE-rev (BamHI)CGATGGATCCATCCCGGTGAAGATGGACCG
    TM0166 PyhcY-fwd (EcoRI)CGATGAATTCGACAGTGAAAAGCGACTTGCC
    TM0165 PyhcY-rev (BamHI)CGATGGATCCGTGTTGCTTTGATATCGTGCC
  • a The sequences that represent the T7 promoter necessary for in vitro transcription are underlined. Restriction sites are in boldface. Linker sequences used for joining reactions are in italic and boldface.