TABLE 1.

DNA oligomers and plasmids

Oligomer or plasmidSequence (5′ to 3′) or descriptionReference or source
Oligomers
    Msm-hspXRT_FpCGGCGTGTTGACCATCAAGThis study
    Msm-hspXRT_RpGATCGTGAGGATGCCTTTGTC
    Msm-udgBRT_FpGGCACAGTGGACGGGTGT
    Msm-udgBRT_RpGAGATCATCGCGTCGAGGTC
    Msm-16SRT_FpAAGCGCAAGTGACGGTATGTG
    Msm-16SRT_RpAAGCTGTGAGTTTTCACGAACAAC
    Msm-ungRT_FpGCAGCCTGTCCAACATCTTCAC
    Msm-ungRT_RpCGGCCTCCCATCCTTTACC
    Msm-mutMRT_FpCACGTCGTTCGATTCGTTGTAC
    Msm-mutMRT_RpGCTGACATCTCGGGCAGTAGA
    Msm-uvrBRT_FpGATGGCGCCCAACAAGAC
    Msm-uvrBRT_RpCGTTGATCGAGCTGTCCTTCTC
    narK2_FpGATATCGTGATCCGACTGGTCGCC
    narK2_RpCCATGGCGAACTCCGCGCCCC
    PTUa5′-A∼T∼ATACCGCGGUCGGCCGATCAAGCTTA∼T∼T-3′16
Plasmids
    pJet1.2E. coli vector for cloning PCR productsMBI Fermentas
    pRAREE. coli plasmid (p15a origin of replication, Cmr), encodes tRNA genes (proL, leuW, metT, argW, thrT, glyT, tyrU, thrU, argU, and ileX)Novagen
    pETMsmUngpET 11D E. coli expression construct harboring ung ORF from M. smegmatis SN2 between NcoI and EcoRI sites (renamed from pETMsmUDG)2
    pRSETbMsmUngpRSET E. coli expression construct harboring M. smegmatis ung between NcoI and HindIII sites along with a 40-amino-acid N-terminal presequenceThis study
    pRSET-11-MsmUngDerivative of pRSETbMsmUng in which the N-terminal 40-amino-acid presequence has been reduced to 11 amino acids
    pTrcHisMsmUngE. coli expression construct with M. smegmatis ung along with 11-amino-acid N-terminal tag from pRSET-11-MsmUng cloned between NdeI and HindIII sites
    pTrcMsmUngpTrc99c harboring M. smegmatis ung ORF between NcoI and HindIII sites1
    pJet1.2narK2pJet vector containing ∼300 bp of narK2 promoter within EcoRV and NcoI sitesThis study
    pTrcnarK2ungpTrcMsmUng vector with narK2 promoter cloned upstream of ung ORF between EcoRV and NcoI sitesThis study
    pMV361 (Hygr)Integrative vector in mycobacteria containing L5 att region with E. coli origin of replication and Hygr marker33
    pMV361ΔhspDerivative of pMV361 vector with hsp60 promoter truncated by BsrDI digestion, end filled, and ligatedThis study
    pMVnarK2ungpMV361Δhsp in which narK2ung from pTrcnarK2ung has been cloned between PvuII and HindIII sitesThis study
  • a The ∼ symbols indicate phosphorothioate modifications in the oligonucleotide.