TABLE 2.

Oligonucleotide primers used for qRT-PCR used in this study

GeneOrientationaPrimer sequence (5′-3′)
fimAFGTTCTGCTGTCGGTTTTAACATTC
RGGGTTGTTTCTGAACTAAATGTCG
sdiAFTGATGAAATAGTGATGACGCCAGAG
RCGTAACAGGCAACCTGGGTCTTATT
tnaAFTGAAGAAGTTGGTCCGAATAACGTG
RCTTTGTATTCTGCTTCACGCTGCTT
yjgKFGAAGGCAATCGACTGTTTTATCTTA
RAAATGCGATGTCTTTATCAGCTAAC
pgaAFGCCAATTTACTCGCAGAAGC
RTGACCAGTTCGGCATGAATA
pgaBFAAGCAGATATTTTTAGTCGGGTTG
RAACTTGTGCTCTGACTCTGTCATC
pgaCFTTAGCACAGCGTTATGAGAACATT
RATCAATGCACACCAGATATTCACT
pgaDFGATCTGCTGACGGGTTATTACTG
RTCAGGTATTGCTAAGCTCTCTGC
rrsGFTATTGCACAATGGGCGCAAG
RACTTAACAAACCGCTGACTT
  • a F, forward; R, reverse.