TABLE 2.

Primers used in this study

Primer nameApplication(s)Sequence (5′-3′)a
est/lip-FAmplification and sequencing of cgl upstream regionGAGTATGATGCTAATGTTCCAGG
cgl-diag-RAmplification and sequencing of cgl upstream region; diagnostic primer for confirmation of pPNG901 integration into genomeCAAAGTTCCGCATCTGCTTAG
cgl-Fcgl insert primerAATTCTAGATAACCAACAACGGGTGCTGTTTC
cgl-Rcgl insert primerCGTGAATTCTTATTGATGAACCCGCATCCGTG
cyuC-FcyuC insert primerAAATCTAGATAAACAGTTGCAGCATTAACACTAG
cyuC-RcyuC insert primerACTGAATTCTTAAATCATCTTAAGGCCCTTAGTAC
mlp-Fmlp insert primerGGATCTAGATAAGCAGATAGCACCACAGCAAATG
mlp-Rmlp insert primerAACGAATTCTTAACCAGTAACAGAACCATTAACG
cgl-diag-FDiagnostic primer for confirmation of pPNG901 integration into genomeGCATAAGGCGCAAATTCAAGTAAG
cyuC-diag-FDiagnostic primer for confirmation of pPNG902 integration into genomeGCTCCAGATAATCCTAATGAAC
cyuC-diag-RDiagnostic primer for confirmation of pPNG902 integration into genomeCTTAACAGTCCCATCCTGTTG
mlp-diag-FDiagnostic primer for confirmation of pPNG903 integration into genomeCTGTTGGTGTAGCGTCTGTTTTG
mlp-diag-RDiagnostic primer for confirmation of pPNG903 integration into genomeCATTGGAAGCTGCAATGTTTG
pORI-Em-start-RpORI28-specific primer for confirmation of plasmid integration into genomeGTTCTCGAGGAACTGTGCTGATTACb
pORI-Em-end-FpORI28-specific primer for confirmation of plasmid integration into genomeTTCCTCGAGACATGCAGGAATTGACGb
cgl_br11_DIGfAmplification of cgl probe for Northern blot analysisTTCTCGTACTGGTAATCCAACG
cgl_br11_DIGrAmplification of cgl probe for Northern blot analysisATGCTAATTGTTCCGCAATCTC
cyuC_br11_DIGfAmplification of cyuC probe for Northern blot analysisATCTTCGGCAGTAAATTCAGAG
cyuC_br11_DIGrAmplification of cyuC probe for Northern blot analysisGTGAACAAAAACCAGCCAAA
  • a Restriction sites are bolded, and stop codons are underlined.

  • b The restriction site was introduced for other experiments.