TABLE 2.

Primers used for gene cloning

GeneForward/reverse primer (5′-3′)a
trkA (SMc01046) TTATCTAGACGATCAGCATATCATGACC/XbaI
TAATCTAGACCACGATCCATACATTCGTCXbaI
kdpA (SMa2333) TAAGAATTCATACCTGCACTGACGAGAAG/EcoRI
TAAGAATTCACATCGAGAACGAAGAAGAGEcoRI
kup1 (SMc00873) TAAGAGCTCGCTACGACATCTTCGGTCAT/SacI
TAATCTAGAGCACTTCCAGGAAAAGTGTGXbaI
kup2 (SMa1798) TAATCTAGAGCCTGTTGACGACGATCAGT/XbaI
TAAGATATCGGGTCCAGATCTAGCTACGEcoRV
  • a Underlining denotes the action sites of the endonucleases used for cloning the mutated gene versions in the shuttle vector.