TABLE 1.

Strains, plasmids, and primers used in this study

Strain, plasmid, or primerDescription or sequenceaReference
Strains
    R. leguminosarum bv. viciae 3841 20
    A34 Rhizobium leguminosarum bv. viciae strain 7
    RU1816 R. leguminosarum bv. viciae 3841 mutant, overexpresses gabD4 47
    RU2516 R. leguminosarum bv. viciae 3841 gabT::ΩTetThis work
    RU2517 R. leguminosarum bv. viciae 3841 gabD2::ΩTetThis work
    RU2518 R. leguminosarum bv. viciae 3841 ΔgabT This work
    RU2519 R. leguminosarum bv. viciae 3841 ΔgabD2 This work
    RU3845 R. leguminosarum bv. viciae 3841(pRU1818)This work
    RU3846 R. leguminosarum bv. viciae 3841(pRU1819)This work
    RU3847 R. leguminosarum bv. viciae 3841(pRU1820)This work
    RU3849 R. leguminosarum bv. viciae 3841(pRU1822)This work
    RU3850 R. leguminosarum bv. viciae 3841(pRU1823)This work
    RU3922 R. leguminosarum bv. viciae 3841 ΔgabT opaA::ΩSpecThis work
    RU3924 R. leguminosarum bv. viciae 3841 ΔgabD2 gabD4::ΩTetThis work
    RU3930 R. leguminosarum bv. viciae 3841 ΔgabD2 pK19mobgabD1 gabD4::ΩTetThis work
    RU4011 R. leguminosarum bv. viciae 3841 ΔgabT ΔopaA This work
    RU4012 R. leguminosarum bv. viciae 3841 ΔgabT ΔopaA opaB::ΩSpecThis work
    RU4016 R. leguminosarum bv. viciae 3841 ΔgabD2 pK19mobgabD1 This work
    RU4104 R. leguminosarum bv. viciae 3841 pK19mobgabD1 This work
Plasmids
    pJQ200SKpACYC derivative, P15A origin of replication; Gmr 33
    pRK415Broad-host-range P-group cloning vector; Tetr 23
    pK19mobUsed to generate mutants in R. leguminosarum bv. viciae 3841; Nmr 40
    pRU1818 gabD1 cloned in pRK415This work
    pRU1819 gabD2 cloned in pRK415This work
    pRU1820 gabD3 cloned in pRK415This work
    pRU1822 gabD5 cloned in pRK415This work
    pRU1823 gabD6 cloned in pRK415This work
    pRU1882 gabT::ΩTet cloned in pJQ200SKThis work
    pRU1883ΔgabT cloned in pJQ200SKThis work
    pRU1884 gabD2::ΩTet cloned in pJQ200SKThis work
    pRU1885ΔgabD2 cloned in pJQ200SKThis work
    pRU1890 gabD4::ΩTet cloned in pJQ200SKThis work
    pRU1891 opaA::ΩSpec cloned in pJQ200SKThis work
    pRU1892 gabD1cloned in pK19mobThis work
    pRU1933ΔopaA cloned in pJQ200SKThis work
    pRU1934 opaB::ΩSpec cloned in pJQ200SKThis work
Primers
    p676CGCAAGAGCGGCATTGAAGG
    p741 TCTAGAGGCGGCGAGTTCGTTGCTTC
    p742 AAGCTTTGCCACCGATGAAGAACAGAGCG
    p743 TCTAGAGCCGCCAGAATTGGTGACAAG
    p744 GGATCCAACTCCTCCCTCATTGTCAGCCG
    p745 GGATCCCGCCGAGCAATGGAAGACGG
    p746 TCTAGACCTCCATGCTGCAAGCAAGC
    p747 AAGCTTGCGACCATGCTGCCCTATGTG
    p748 TCTAGACGGTGATGGTCTCAGCGACGC
    p751 TCTAGACTATGCTATGACGATGATCGAGCTG
    p752 AAGCTTCTCCGCCAATATCAATCCCGA
    p759AAAAGTCCGCCAGATCGCCCGTCC
    p760ACCATCCAGGACGAGATCTTCGG
    p761CACGTCGAAAGTCTTTGTGGCATCG
    p762AGAACTGATCGCCGTCGAGCACC
    p767TTGCAGCGAAGGAAAGAGCGGCC
    p768TCGCTTGTGTCGCTCCTGTCAGG
    p825AGGCGAGCCGCTGGGGGTGGTGC
    p826TTCGATCATCAGCCGGTGCC
    p859TGACGGCTGAACAGGGCAAG
    p860CGCCTTGCGTGTGATCATTG
    p861CGGGGCGATCTTGCGAGTGA
    p862CGAAATGGGCAAGCCGTTCC
    p890CCAGCAGACCGAAGTGACGA
    p891GGCACCATGTAGAAGCCGTG
    p899GGCGAAGATCATTAGCCACC
    p900ATAGTAGGCGTCACCCGCTC
    p992TTCCTGCTGGCAAAGACCGC
    p993GGTTCTGCCTGCGAAGGGCT
    p994CCTCTGGTGCGTCAATGCCG
    p995AGCGCGGGTTCGACGGATTC
    p1000AGGAATTTGCAGCCCGACCG
    p1240CTCGTCCTGGATGGTGATTGG
    p1241GGAATCAATGCGCGAGACG
  • a Restriction sites are shown in bold type.