TABLE 1.

PCR primersa

GeneForward primerReverse primer
sgaHGAAGGAATTGCATATGTCATTACCGATG (NdeI)GGACAACATATCGGATCCTTAGCCCC (BamHI)
sgbHGGAGCACACCATATGAGCCGACCAC (NdeI)CATAAATCCCTAACGGATCCTTACGCACGCG (BamHI)
sgaUGGCTAAGGACATATGATGTTGTCCAAAC (NdeI)TTAGCTTTTGGATCCTGCCGCCTCCAC (BamHI)
sgbUGCTGGCGCATATGATGCGCAAATCG (NdeI)GCTTTCACTCGAGCTAACATATAAATCC (XhoI)
sgaEGGAGGCCATATGATGCAAAAGCTAAAAC (NdeI)GCAGCGGGATCCCTACTTCTGCCC (BamHI)
sgbEGGAGGCTGGCATATGATGTTAGAGCAAC (NdeI)GGCGTGGATCCTTACTGCCCGTAATAGG (BamHI)
yiaKCAAGGAAGCCTCATATGAAAGTGACATTTGAGC (NdeI)TGACTTCTCGAGTCATAACGCCTGGATTTTGG (XhoI)
lyxKGAGGTGCAAGTCGACATGACGCAATAC (SalI)GCAGAAGTGGGATCCTCATAATGTGTG (XhoI)
sga operon deletionCGTCGCATTACCGGCATTCGCACAATCATGTTGACCGGCCACGTGTAGGCTGGAGCTGCTTC (pKD13 site 1)GCTTAACCCGCGCGTACACGGAATGTCGCCAAAGAAGTAGTCATTCCGGGGATCCGTCGACC (pKD13 site 4)
sgb operon deletionGCCGATCACGGTATTGGTCTGGTGGCACTACGTAATGCCAACGTGTAGGCTGGAGCTGCTTC (pKD3 site 1)CGGGCCGTGAGAATGCACCAGCACCGCCGGGATTTGTGCCGGCATATGAATATCCTCCTTAG (pKD3 site 2)
  • a Restriction sites and priming sites are shown in bold and indicated in parentheses.