TABLE 2.

Primers used in this study

Primer nameSequence (5′ → 3′)
EF3056e-f3GCTCTAGAAGTAATTCAGGACTTAATTTTTCGACAGGCGT
EF3056e-r3GCTCTAGAGAAGGAGTGAAACGTTGTGGTAACTGTG
EF3056 sew-fGTGGTAAACTTGATACATTAAAAGGAGGGAAAATTGGGTGGCTTAATAAAAAAATCCTTGAAAAGTTTTGACACTTTTC
EF3056 sew-rGAAAAGTGTCAAAACTTTTCAAGGATTTTTTTATTAAGCCACCCAATTTTCCCTCCTTTTAATGTATCAAGTTTACCAC
EF1094e-f3GCTCTAGAATAACGTGACTTCTGGAGAGTATGCTTATGC
EF1094e-r3GCTCTAGACGCGGAACAAAGGAGCTAAAAACTTAATAGAATA
EF1094 sew-fCTGTCCCAGGCTCTCATGCTTTATTTTTAAGGAGGAAGCATAGTATGACGAAAAGGCTAAACATACTAAAAAAAAGAG
EF1094 sew-rCTCTTTTTTTTAGTATGTTTAGCCTTTTCGTCATACTATGCTTCCTCCTTAAAAATAAAGCATGAGAGCCTGGGACAG
EF1094e-f1GGAATTCCGAAGTGGCGCAGTCTTGCTAC
EF1094e-r1GGAATTCCCAGTCGATTGATTGGCCCTTTGTCG
EF3056e-f1GGAATTCCCCCTCTACTAGCCTCCTTACCATTTTAC
EF3056e-r1GGAATTCCGTTGATAATGAGTCTGCCGCTAGTGTATG
EF1094i-f2CCGGAATTCAAGGAGGAAGCAATGAAGTCAAAAAAGAAACGTCGTATCATTG
EF1094i-r5AAAACTGCAGCTAAGCATAATCTGGAACATCATATGGATAAGCATAATCTGGAACATCATATGGATACTTTGGTTTTCTGGTCGTCTTTTTCCGTCGC
EF1094 tail delete-rAAAACTGCAGCTAAGCATAATCTGGAACATCATATGGATAAGCATAATCTGGAACATCATATGGATAGTACCAGATAATGAAGCCGCTAATAATTAACGCACAGGC
EF1094(+/−)tailAACTGCAGCTAAGCATAATCTGGAACATCATATGGATAAGCATAATCTGGAACATCATATGGATACTTTGGTTCTCTGGTCGTCTCTTTCTCTCGATCGTACCAGATAATGAAGCCGCTAATAATTAACGCACAG
EF1094(−) tailAACTGCAGCTAAGCATAATCTGGAACATCATATGGATAAGCATAATCTGGAACATCATATGGATACTCTGGTTCTTCGGTCGTCTCTTCCTCTTCATCGTACCAGATAATGAAGCCGCTAATAATTAACGCACAG
EF3056i-f2CCGGAATTCAAGGAGGGAAAATATGCGCCCAAAAGAGAAAAAAAGAGG
EF3056i-r3AAAACTGCAGTTAAGCCACCCAATCGGCTAAAGTTTTTTGCTCCAATTGG
EF3056e-f5CGGGATCCCCGCGTTGCTGGTTACATCTATATGTAC
EF3056i-r7AAAACTGCAGTTAAGCATAATCTGGAACATCATATGGATAAGCATAATCTGGAACATCATATGGATAAGCCACCCAATCGGCTAAAGTTTTTTGCTCC