TABLE 2.

Primers used in this study

Purpose and nameSequenceaRestriction site and/or tag
Construction of SP4-tagged proteins
    STM1344-SPA-F TGGCCTCCGGTGCCGGTAAGCCAGCTCATTAAACTCGTTCAGCGA TCCATGGAAAAGAGAAG
    STM1344-SPA-R AGTGTAGACGGTTAATCACCGGTTAAACACCGGCAAACAGAAAGG CATATGAATATCCTCCTTAG
    STM3611-SPA-F CGACCCGTGCCGCTGATATCGCTCGAAGAGGTGATTCTGACCCTGTCCATGGAAAAGAGAAG
    STM3611-SPA-R ATGACCGCGCCTCGTAATACCACGTATTACGGGAACAGTCTGGCGCATATGAATATCCTCCTTAG
    STM1703-SPA-F TCTTTTGAACGCTGGTACAAACGTTATCAGACGAAAAAAATGCGT TCCATGGAAAAGAGAAG
    STM1703-SPA-R GGCTATGCCTGTCTGCACAGGCTGTTCTCCCTATTATCGTCGCCA CATATGAATATCCTCCTTAG
SP4-tag control
    STM1344_SPA_control TGCACGCTATTGTTGCCCA
    STM1344_Control_Reverse GGGCAGTAAAAGACAGGGT
    STM3611_SPA_control TGCTGCTGCAACTGATGAAC
    STM3611_Control_Reverse TGTGATGGCGGCGGTTATT
    STM1703_SPA_Control AGGCGCTAAATTTACAAGTG
    STM1703_Control_Reverse AAATTGATTGTTGTCGGGAGT
Cloning
    STM1344_pET23a_Start CGTGGCTAGCATTGCTTCACTTGATGAGCTT NheI
    STM1344_pET23a_Stop CCTAAGCTTTCGCTGAACGAGTTTAATGA HindIII
    STM3611_pET23a_N-FLAG_Start AGCCATATG GACTACAAAGACGATGACGACAAG GGTATAAAGCAGGTTATCCAGCA NdeI, FLAG tag
    STM3611_pET23a_N-Tag_Stop AGCAAGCTTTTACAGGGTCAGAATCACCTCT HindIII
Construction of variant STM1344
    E29A_forward2 TTGGTTTAGCAATTATTGCAACGT
    E29A_reverse2 GTTGCAATAATTGCTAAACCAACAA
    N85A_forward CATGGCTTGCATTACCGCCTGCAATTAGTGA
    N85A_reverse GCGGTAATGCAAGCCATGCAATAAGTTTATGC
    F144A_forward CTGGCAAATGCTGGGGCAGGCGAGGCG
    F144A_reverse TGCCCCAGCATTTGCCAGCATTAATGGGA
    D165A_forward GTCATGTTGGCTAAAAATTTTATTCAGCAGCGAG
    D165A_reverse TAAAATTTTTAGCCAACATGACTCGTTTGAAAA
    F168A_forward TTGGATAAAAATGCTATTCAGCAGC
    F168A_reverse CTGCTGAATAGCATTTTTATCCAAC
RT-PCR
    recA_forward GGCGAAATCGGCGACTCT
    recA_reverse CATACGGATCTGGTTGATGAAAATC
    STM1703_forward GGCGCAGGAGCTCTCTTT
    STM1703_reverse GCAATGACTGAGTTGGCTTCTG
    STM3611_forward CTGCTGCTGCAACTGATGAAC
    STM3611_reverse CTCCACGCCCTCGACAAT
    csgD_forward ACGCTACTGAAGACCAGGAAC
    csgD_reverse GCATTCGCCACGCAGAATA
Sequencing
    pBAD_MCS_Start ATCGCAACTCTCTACTGTTTC
    pBAD_MCS_Stop CTGATTTAATCTGTATCAGGC
  • a SPA tag-specific priming sequences are underlined only, the FLAG tag sequence is in bold and underlined, restriction sites are shown in italics, and nucleotide exchanges leading to amino acid replacement are shown in bold.