TABLE 1.

Oligonucleotide primers, plasmids, and strains used in this study

Primer, plasmid, or strainSequence (5′→3′) or descriptionaRestriction enzyme(s)Reference and/or source(s)
Primers
    112AAAgtcgacTAACAGGTTGGCTGATAAGTCCCSalI
    24AAACTGCAGGTACCCGGGTTCCAGTTTGTAATACGACTCACSmaI, KpnI, PstI
    29AAACTGCAGAAAACTAGTCTCGAGTGGGGTACGCGTAATACGACTCPstI, SpeI, XhoI
    26AAAAAGCTTGGATCCTAACAGGTTGGCTGATAAGTCCCBamHI, HindIII
    30AAACTGCAGCTAAAGTTATGGAAATAAGACTTAGPstI
    31AAAACTAGTATTCAAATTTATCCTTATTGTACAAASpeI
    113AAAGGATCCAATTTTGCAAAAAGTTGTTGACTTTATCTACAAGGTGTGGCATAATGTGTGTCGGCCGATAAAGCAAGCATATAATATTGCGTTTCATCBamHI, EagI
    114AAAAAGCTTGTCGACTTATTCAACATAGTTCCCTTCAAGASalI, HindIII
    134AAACGGCCGATGGAAAAAAAGGAATTTCGTGTTTTGEagI
    229AAAGTCGACTGGAACCGGAGAAGAAACGCSalI
    230GTGTTTTTTAGTGCTTATTTAGATCCAAGAATTAATTTCTTCTTCAT
    231ATGAAGAAGAAATTAATTCTTGGATCTAAATAAGCACTAAAAAACAC
    232AAACTGCAGGAAACAGTAGACCTATTCTTGCPstI
    241AACGGCCGTTTCACACCAATCGGACATTCCEagI
    242AACGGCCGACCATAAGAATATCATTAAATTTCTTTCEagI
    243AACGGCCGATGAAGAAGAAATTAATTCTTGGACEagI
    249AAAGTCGACTAAAGTACTAAAACATACAAAACCGSalI
    MSPY5ACTACGCACCGGACGAGACGTAGCGTC79
    MSPY3p-CGGACGCTACGTCCGTGTTGTCGGTCCTG79
Plasmids
    pBADC939
    phiMycoMarT765
    pUC19Invitrogen
    pLTV34
    pKSV775
    pPL242
    pJZ025This study
    pJZ026This study
    pJZ029This study
    pJZ032This study
    pJZ037This study
    pJZ039This study
    pJZ064This study
    pJZ065This study
    pJZ066This study
L. monocytogenes strains
    10403SWT3
    DP-L5539Himar1 transposon generated library, strain 10403SThis study
    DP-L5558Transposon insertion into lmo0964This study
    DP-L5566Transposon insertion into lmo1268This study
    DP-L5570Transposon insertion into lmo1401This study
    DP-L5575Transposon insertion into lmo1609This study
    DP-L5577Transposon insertion into lmo1695This study
    DP-L5580Transposon insertion into lmo1821This study
    DP-L5596Transposon insertion into lmo2219This study
    DP-L5600Transposon insertion into lmo2460This study
    DP-L560110403S ΔprsA(29-291)This study
    DP-L560210403S ΔprsA(29-291) tRNAArg::pPL2 with construct 1This study
    DP-L560310403S ΔprsA(29-291) tRNAArg::pPL2 with construct 2This study
    DP-L560410403S ΔprsA(29-291) tRNAArg::pPL2 with construct 3This study
    DP-L560510403S ΔprsA(29-291) tRNAArg::pPL2This study
    DP-L216110403S Δhly33
    DP-L560610403S Δhly prsA2::Himar1This study
    DP-L405710403S LLOS44A22
    DP-L560710403S LLOS44A prsA2::Himar1This study
    DP-L436110403S LLOFLAGThis study
    DP-L560810403S LLOFLAG prsA2::Himar1This study
    DP-L861SLCC-576444
    DP-L5609SLCC-5764 prsA2::Himar1This study
    DP-L193510403S ΔplcB74
    DP-L465010403S ΔflaA85
    DP-L431710403S ΔprfAH. Shen and J. F. Miller; 10
    DP-L348110403S LLOHis620
    DP-L563310403S LLOHis6 prsA2::Himar1This study
  • a Underlining indicates restriction enzyme sites. ΔprsA(29-291), the deletion in prsA resulting in the removal of amino acids 29 to 291; p-, 5′-phosphate.