TABLE 2.

Primers used in this study

PrimerSequenceDescription
1GAACATATGTTTGCATGGAGGTo make plasmid for allelic replacement
2CAAGCTCTGGGGCACTAGTTTo make plasmid for allelic replacement
3ATTGTAAAGAGTGAAGGGAGTo construct pTS1303,1304
4AAAGTTGGACAATCTATCCTATo construct pTS1301
5AGGATAGATTGTCCAACTTTTo construct pTS1308-1310
6TTTATGGGTAACTATGATGTTo construct pTS1305
7ACTTGTTCCTATCATATGTATo make CPE1563 probe
8ATTCTTCCTCCGCTGTCACTTo construct pTS1314
9AGTGACAGCGGAGGAAGAATTo make CPE1562 probe
10ATGGTATTCATACAATATTGTo construct pTS1306
11TTTAAACCTTCACATAAATo make CPE1562 probe
12TAGGTATTCCATCTACTATSequence primer
13TTTTTCAGCTATTAACTTCGATo construct pTS1313,1314
14TTTACAGCAAGCATACTTATo construct pTS1310,1311, to make CPE1561 probe
15TTCTGGAGGAGCACATTCAGTo construct pTS1302
16TCCTTAGAGTCATACATTGCTo make CPE1561 probe
18TTGTTAAAAACTATAGATTCTTTo check mutation, agrD Northern
19GGCCGGTTTAAAACCTACCTTo check mutation, agrD Northern
20TATACTAGATTAGAGAGGGAGAATTo make CPE1560 probe
21CTCTTCTCCTCCATATCTAGCTo make CPE1560 probe
22ACTTCAGCTAAGCTATGCTGTo construct pTS1302
23AAGGTCATAGGTGTTGTATAGCTo make plasmid for allelic replacement
24TAACAGTACGTGTTCCAAACTo construct pTS1301,1303
25AGATGGGGCGGTAGACGTAGTo make plasmid for allelic replacement