TABLE 2.

Oligonucleotides

Oligo- nucleotideSequencePositionsd
cdo2 TATCTGCAGTTTGGAGAATGGCAGCGC465-488a
cup2 TATCTGCAGTTOGCGCTTAGCTGG469-450a
cdo11 TATCAAGCTTTACATCTGACAATGAG787-808b
cup11 TATAAGCTTGAACGTGTTACGACCGC792-770b
Tn7int∗179ECCCAGCAATAAAAGAGCTCATTGAGCAAGC1393-1364
Tn7SRS-107TATCTAGAAACAGAGTGTCTTG2118-2131
Tn7CRS+185TTAAAGCTTATGGAGTTGTCGTAGTTGC4424-4402
Tn7 Fling ATAAAGCTTACGACAATAGTCCATC4426-4444
Tn7-int32 ATTGGATCCTGATTGATAAGTAG940-954
Tn7-int36AGTGACACGCTTGCTAAC1123-1140
Tn7-int37AGTTGTCGTCTTGCTGAATAAG1338-1359
Tn7-int38TAACTTGGTTGCGAGTATCC1542-1561
Tn7-int53ATCATCTGCATGACTCCGTTG1202-1182
Tn7-int55 TATGCATGCTAGAATAGGCTGTATAG1962-1944
Tn7left1 TAGAATTCGTAGCGTCGTAAGCTAATAC95-115
Tn7left2 TTGGATCCTGCGGATGGACTGATG973-955
Tn7left3TCCTATATCCAACTGATCAT204-223
Tn7left4ATAAACAATCATAGAGGG875-858
Tn7left5ACAGTAACAAGCATTACGAGG415-435
Tn7left6TTGTTACTCCAAGAGCTTG585-603
Tn7left7AATGGTCACTGTGATTGACAG787-807
Tn7left8TCTGAAGCACATTTCTTATAC629-651
Tn7left9ATGTTAATGGGCTATTACAATG391-369
Tn7right1AAAGAAGATCAGACTCGTAG5278-5259
Universal 17-nteGTAAAACGACGGCCAGT
Reverse 16-ntAACAGCTATGACCATG
sat1up2ATGGAACGATCTAGCCTCTAT249-269c
sat1do2TGTGCGCGACTCCTTTGCCTC319-299c
pHin GGCAAGCTTAGTAAAGCCCTCGCTAG2055-2030a
pSphTGATCCGCATGCCCGTTCCATACAG709-733a
  • a Published sequence (37).

  • b Published sequence (39).

  • c Published sequence (38).

  • d Primer positions are as in Fig. 2A except as noted.

  • e nt, nucleotide.