TABLE 2.

Putative Rho-independent terminatorsa in the SfV genome

LocationSequence
Direct
    5547-5584TGTGCCCGCGTTCTGGCGGGCACAGGAGGTTTTATGCT
    33675-33710AACCCGCCGCTGAGCGGGTTTTTTTGTGCCTTGATG
    35222-35253GGCCACGTTGCGTGGCCTTTTTATTTCCAACA
Complement
    17807-17770CCCCCCCGAAACTTAGGGGGGGATCTGCAGTTATAATT
    25066-25034ATCAAAAGTCATTTGATTTTCCTTTTATGTAT
    25673-25649AACCTGCTTCGGCAGGTTTTTTTATACTTGAC
  • a The Rho-independent terminators were identified by using the GCG Terminator Program. The stem-loop structures are indicated by bolding and underlining, respectively.