TABLE 2.

Primers used in this study

PrimerNucleotide sequence
Insertion, deletion, and complementation primers
    cpxA_del_AATCGTCTAGAAACCCTCAAGCGTCTGCG
    cpxA_del_BAGGTAATTTCGGTAACGGTAGACGCAT
    cpxA_del_CCCGAAATTACCTCTGGCGAGCGCTTAA
    cpxA_del_DCGATTCTAGATGACGTTCGATCTCTGCG
    envZ_del_AATCGCCATGGCGCCAAGTGATTGAAGCG
    envZ_del_BCTTAGTTGAACTGCGAATTCGCATAAG
    envZ_del_CAGTTCAACTAAGCAGCAAAAGGGCTAA
    envZ_del_DCGATTCTAGAGTATTGGCTGATGGCCTC
    oscR_del_ACATGCCATGGGCCCAAGCAAATCAGGTCAGT
    oscR_del_BCTGGTGGCAACTTTGTTTCGTTCATGTGTGC
    oscR_del_CCGAAACAAAGTTGCCACCAGAAAGGTAATTG
    oscR_del_DGCTCTAGAGAAGCGCGATAAAGCAAAGTG
    VCA0030_ins_FGCTCTAGATTTGGCTTTATGACCGTGTG
    VCA0030_ins_RGGAATTCCGGCCATCCAACACATAATGA
    oscR_comp_FCGGGATCCTGTTTTTGGACTGAGTCAGCCTTAT
    oscR_comp_RTCCCCCCGGGGATGTACGATGTAAACGGTAGCGTT
Promoter-lacZ fusion primers
    Knockin_AATCGTCATGAACGATGATAACCAATCGC
    Knockin_BAGTCTAGACTCCATGGCCCTCAAGCCGAGGAGT
    Knockin_CAGTCTAGACTGAGCTCGCCAGAGAGCCTTAAGGC
    Knockin_DTGCCGATCAGCGTATTGC
    ectAp_FGCTCTAGAATTCCTTGCAAAGGGATTTT
    ectAp_RCATGCCATGGCCAAGGCGTACGGTAAACAT
    vpsLp_FATCGCCATGGTCTAGATACGATCGCTTGAGCAAGC
    vpsLp_RCGATCCATGGTAGACGCTCCTAACCGATG
    VC2037p_FGCTCTAGACAAAATCGCGCTCTTCTACC
    VC2037p_RCATGCCATGGATACTAAGAGCCTCTTATCCAATC
qPCR primers
    ectA_FTTGGTCGGATTTGTTTCTGC
    ectA_RTTTCAAGAACCGTGATGTCG
    gyrA_FTGTGGGTGCAGTACAAGTGG
    gyrA_RAAGTACGGATCAGGGTCACG
    oscR_FGCAAGTACCGCTCAGTAGCC
    oscR_RGGTTATGTTGGCTGGTTTCG
    vpsR_FACCTGGTCTCTTGTTGTGG
    vpsR_RTCTCGACAAATAACGCATCG
    vpsT_FGAAAGTCGCAGTATTCAGATGC
    vpsT_RTGCGGACAGTTTATGATGACC
    VCA0822_FGCGTATGCTGCTGATTAACG
    VCA0822_RGTCCATATTGGCAGGTTTGC