TABLE 2.

Bacterial strains, plasmids, and oligonucleotides used in this study

Strain, plasmid, or oligonucleotideGenotype or characteristicsaReference or source
E. coli strains
    W3104Wild type, used as the donor of chromosomal DNA for PCR amplification30
    TG1supE hsdΔ5 thi Δ(lac-proAB) F′ [traD36 proAB+ lacIq lacZΔM15], used as the cloning host28
    DH5αrecA endA1 hsdR17 supE4 gyrA96 relA1 Δ(lacZYA-argF)U169 (φ80dlacZΔM15), used as the cloning host24
    M15recA+ uvr+ F mtl gal ara lac (pREP4), used for overexpression of hexahistidine-tagged EvgAQiagen
    CJ236dut-1 ung thi-1 relA1/pCJ105(Cmr F′), used for mutagenesis by the Kunkel method (7)7
    ZK796Tetr; same as MC4100 but tolC::Tn1032
    KAM3Derivative of TG1 that lacks a restriction system and acrAB13
    KAM3ΔyhiUVDerivative of KAM3 that lacks yhiUVThis study
    KAM3ΔevgSDerivative of KAM3 that lacks evgSThis study
Plasmids
    pUC119Vector; Apr; multiple cloning site in lacZ31
    pQE30His expression vector; Apr; multiple cloning site downstream of T5 promoterQiagen
    pKO3repA(Ts) Cmr sacB+8
    pKO3ΔyhiUVBamHI-BamHI fragment for yhiUV deletion cloned into pKO3This study
    pKO3ΔevgSBamHI-BamHI fragment for evgS deletion cloned into pKO3This study
    pUCAHindIII-SalI fragment containing evgA (gene regulator of two-component system) with 366-bp upstream flanking sequence cloned into pUC119 to be in the same orientation as the lactose promoter; Apr16
    pUCA-D52AD52A derivative of pUCAThis study
    pUCA-D54AD54A derivative of pUCAThis study
    pQE30emrKYSphI-PstI fragment containing emrKY (MFP/ MFS transporter) genes cloned into pQE30; Apr16
    pQE30evgASphI-PstI fragment containing evgA gene cloned into pQE30; Apr16
    pUCyhiUVPstI-BamHI fragment containing yhiUV (MFP/ RND transporter) genes with 180-bp upstream flanking sequence cloned into pUC119 to be in the same orientation as the lactose promoter; Apr15
Oligonucleotidesb
    evgA-D52ACCGGGGATGTCGACAGCAATGATGACG, mutagenic primer for D52A of evgA
    evgA-D54ACCGGGGATAGCGACGTCAATGATGACG, mutagenic primer for D54A of evgA
    yhiU-NoCGCGGATCCCAGTTCAAAATTATGCAACTGATTCTG, used for crossover PCR for the in-frame deletion of yhiUV
    yhiU-NiCACGCAATAACCTTCACACTCCAAATTTATAACCATTTTAGTCCCTGAAAATTCTTGAG, used for crossover PCR for the in-frame deletion of yhiUV
    yhiV-CoCGCGGATCCCGTCAAATTCCTCTGCATACTATTGC, used for crossover PCR for the in-frame deletion of yhiUV
    yhiV-CiGTTATAAATTTCGAGTGTGAAGGTTATTGCGTGTAACGTGTAAATGAGAGTAAGGTTGA, used for crossover PCR for the in-frame deletion of yhiUV
    evgS-NoCGCGGATCCGGGTGGAAACACTTAAGCCTGA, used for crossover PCR for the in-frame deletion of evgS
    evgS-NiCACGCAATAACCTTCACACTCCAAATTTATAACCATGTGGTTAGCCGATTTTGTTAC, used for crossover PCR for the in-frame deletion of evgS
    evgS-CoCGCGGATCCCATGGCACCTTTTGATGTTTTCAATACT, used for crossover PCR for the in-frame deletion of evgS
    evgS-CiGTTATAAATTTGGAGTGTGAAGGTTATTGCGTGTAAATAGCGGCTCCCACAATGTTC, used for crossover PCR for the in-frame deletion of evgS
    yhiUpr-FCTCTCTACCGCCAGCAATGCCCGC, used for amplification of yhiU probe
    yhiUpr-RCCCGTAATCGGCGAGGTGACATTCGCG, used for amplification of yhiU probe
    evgAFGGGGCATGCAACGCAATAATTATTG, used for amplification of evgA cloned into pQE30
    evgARCCCCTGCAGTTAGCCGATTTTGTTACGTTGT, used for amplification of evgA cloned into pQE30
    macAPFACATTGAGATTAGGCCAGGGAAAGTTCG, used for amplification of macA promoter region
    macAPRTCCGGGTCATTAACTTCAACGAAATATCAA, used for amplification of macA promoter region
    emrKPFAGAAAATCTGAGCTTCCTTAAG, used for amplification of emrK promoter region
    emrKPRCTGTTCCACTATTATCTCTCATTTC, used for amplification of emrK promoter region
    yhiUPFTCAGGACATAAGCAACTGAAATTG, used for amplification of yhiU promoter region
    yhiUPRTTTAGTCCCTGAAAATTCTTGAG, used for amplification of yhiU promoter region
  • a Ap, ampicillin; Cm, chloramphenicol; MFP, membrane fusion protein; MFS, major facilitator superfamily; RND, resistance-nodulation-cell division family.

  • b Introduced restriction sites used for cloning are underlined.