TABLE 1.

Oligonucleotides

Use and nameSequencePositionaPurpose or 16S rRNA mutation
Sequencing, cloning and PCR
    Hp125′ATATGCATGCGAAAACCAAGAAAGTCTGG3′−603 to −585PCR, forward, SphI
    Hp135′ATATGGATCCAAGCAAAATTTAAAACAAAACAC3′1766 to 1788PCR, reverse, BamHI
    Hp15′AGAGTTTGATCCTGGCTCAG3′8 to 27PCR, forward
    Hp35′CGACCTGCTGGAACATT3′693 to 709PCR, forward
    Hp75′ATCCTAAAACCTTCATCCTC3′412 to 393PCR, reverse
    Hp85′TCGTTGCGGGACTTAACCCAA3′1073 to 1053PCR, reverse
    Hp95′AAGGAGGTGATCCAGCCGCA3′1503 to 1484PCR, reverse
    Hp145′AGACGCATGCATTTTCCCAAACATTCCCTA3′−528 to −507PCR, forward, SphI
    Hp155′ACCTGGATCCAACAAAGACAAAAAGCTAA3′1688 to 1712PCR, reverse, BamHI
Mutagenesis
    Hpmut15′AGGCAGCAGTAAGGAATA3′335 to 352G360A, forward
    Hpmut25′TATTCCTTACTGCTGCCT3′351 to 334G360A, reverse
    Hpmut35′GCGAAAGCΔTGGGGAG3′724 to 740Deletion G771, forward
    Hpmut45′CTCCCCAΔGCTTTCGC3′740 to 724Deletion G771, reverse
    Hpmut55′CACAAGCGΔTGGAGCA3′897 to 912Deletion G942, forward
    Hpmut65′ATGCTCCAΔCGCTTGT3′913 to 898Deletion G942, reverse
    Hpmut75′AGCATGTGGTTTAATTCGATTCTACAC3′909 to 935AGA965-967TTC, forward
    Hpmut85′TTCTTCGTGTAGAATCGAATTAAACCAC3′941 to 913AGA965-967TTC, reverse
    Hpmut95′GTGGTTTAATTCGATGATACAC3′914 to 935A965T, forward
    Hpmut105′GTGTATCATCGAATTAAACCAG3′935 to 913A965T, reverse
    Hpmut115′GTGGTTTAATTCGAATATACAC3′914 to 935G966T, forward
    Hpmut125′GTGTATATTCGAATTAAACCAC3′935 to 913G966T, reverse
    Hpmut135′GTGGTTTAATTCGAAGCTACAC3′914 to 935A967C, forward
    Hpmut145′GTGTAGCTTCGAATTAAACCAG3′935 to 913A967C, reverse
    Hpmut155′GCTGCACGCCTGTCGTCAGC3′1018 to 1037G1058C, forward
    Hpmut165′GACGACAGGCGTGCAGCAC3′1034 to 1016G1058C, reverse
  • a Position 1 is designated as the first residue of the consensus H. pylori 16S rRNA sequence as described in the work of Eckloff et al. (7) and shown in Fig. 1. Restriction sites and mutated residues are underlined. A subscript uppercase delta indicates the position of a nucleotide deletion.