TABLE 1.

Strains, plasmids and primers used in this study

Strain, plasmid, or primerSequenceaRelevant genotype or descriptionReference or source
Strains
    Burkholderia cenocepacia
        J2315Multidrug-resistant isolate belonging to the ET12 lineage; from cystic fibrosis patient6
        J2315 rpfFrpfF in-frame deletion mutant of J2315, created using pEX18TcThis study
        J2315 rpfF(pBcam0581)rpfF in-frame deletion mutant, expressing the pBcam0581-complementing constructThis study
        J2315 fliJfliJ insertion mutant of J2315, created using pEX18TcThis study
        J2315 cblAcblA insertion mutant of J2315, created using pEX18TcThis study
        J2315 cblScblS insertion mutant of J2315, created using pEX18TcThis study
        J2315 cblDcblD insertion mutant of J2315, created using pEX18TcThis study
    Escherichia coli
        JM109endA recA1 gyrA96 thi-1 hsdR17 lacIqZΔM15 relA120
Plasmids
    pEX18TcBroad-host-range allelic exchange vector; Tcr8
    pBBR1MCSBroad-host-range cloning vector; Cmr13
    pBcam0581rpfF cloned into pBBR1MCSThis study
    pCR-Blunt-TOPOCloning vector for blunt-ended PCR productsInvitrogen, Carlsbad, CA
Primers
    For construction of deletion mutant
        RPFFUFggatccGCGCGCCCGCTCCACTC
        RPFFURATCTCACGAGGACATACC
        RPFFDFTGCGACGGGCGCCGCCGACG
        RPFFDRaagcttCGTCGGCGGCGCCCGTCGCA
    For construction of complementing clone
        RPFFCOMFggatccGCGCGCCCGCTCCACTCGAGTCC
        RPFFCOMRaagcttTTACACCGTGCGCAGCTTCG
    For construction of insertional mutants
    BCAL0521IFCACGGCTTTCCCCTTCAGAmplifies an internal 459-bp region of bcal0521 (fliJ)
    BCAL0521IRGATCTTCGCGGCGTGTTC
    BCAM2759FGACACCACCGACAAGAACAAAmplifies an internal 494-bp region of bcam2759 (cblD)
    BCAM2759FAACGTGATCGTCAGCTTGTG
    BCAM2758FAATACTTCGTTCGCCACAGCAmplifies an internal 493-bp region of bcam2758 (cblS)
    BCAM2758RCGGATCTCGTGACTGACAAA
    BCAM2759FTGCTGCTCTGATGTCGATGTAmplifies an internal 406-bp region of bcam2759 (cblA)
    BCAM2759RGACGGCTTCGACCTTCTTCT
    For use in RT-PCR analysis
        RTBCAL3270F (dnaK)AGATCGCCGTGTATGACCTC
        RTBCAL3270RCCTGCTCCTTCTTGAACTCG
        RTBCAM2758F (cblS)GGATGATCCGTCAGGAAGAA
        RTBCAM2758RTCCAGTGTGTTATCCGCATC
        RTBCAM2757F (cblT)GGGTTGCGCTTTGAGTATGT
        RTBCAM2757RCTCACGATGGTGTTGCTGAG
        RTBCAM2756F (cblR)GCCAGTTACCTGACGGAGAA
        RTBCAM2756RATCATCAAGATCCGGCAATC
        RTBCAM2759F (cblD)GGTCTATCTGCCGGAGTTCA
        RTBCAM2759RTCGAGCAACGTGGAATACTG
        RTBCAM2762 (cblB)GGTCAACTTCAGCCTCGTCT
        RTBCAM2762GGTAGACACTGCGGTCGAAT
        RTBCAM2760 (cblC)TATTCGAGGGGATCGGATAG
        RTBCAM2760ACATAAGCCAGCGTCGTACC
        RTBCAL0521F (fliJ)GGGCTCACCACGTACAAGAA
        RTBCAL0521RGCTTCTTCTGCTGCCAGTTC
        RTBCAM07911F (mfsP)GCTATCGCGACGAATACCAC
        RTBCAM07911RGCTTCTTCTGCTGCCAGTTC
  • a Restriction sites in primer sequences for BamHI and HindIII are underlined and in lowercase letters.