TABLE 2.

 Primers used to construct the comCDE and comX deletion mutants by PCR restriction-ligation mutagenesis

PrimerNucleotide sequence (5′ → 3′)aAmplicon (bp)
ComCDE-P1CAAAAGGAAAAAAACGGCAG992
ComCDE-P2GGCGCGCCCGGAAAAATGTTGATAGGCTTC
ComCDE-P3GGCCGGCCCGCAATGGTGGTTTCAAGACG1,407
ComCDE-P4CGGGTTTCAGGAACAGAAGC
Erm cst-P1GGCGCGCCCCGGGCCCAAAATTTGTTTGAT860
Erm cst-P2GCTGGCCGGCCAGTCGGCAGCGACTCATAGAAT
ComX-P4GGTTCTACAATTTCACCTTTACCTG685
ComX-P3CGCTGGCCGGCCCACTTTTTGGGAAGGCAAAG685
ComX1-P2BGGCGCGCCTTGTTGCCAATCTTCACGAG876
ComX1-P1AACACAGCAGTTAAGCCCTAGC
  • a The following restriction enzyme sites are indicated in bold: AscI (GGCGCGCC) and FseI (GGCCGGCC).