TABLE 2.

Oligonucleotides used for PCR and sequencinga

Primer nameOligonucleotide sequence (5′-3′)Use
SPOA5UPGGAGTTTATATTGAATGgATCCTTAAAAGPCR spo0A gene
3SPOA3DNTTACTATTCCTTGGTgATCATTAAAGAAAPCR spo0A gene
BSPOFP5′atggatccGCCTGACCTTGTTGTTCTCGATAPCR spo0A fragment
BSPOFN3′cgggatccaCGTGACCATGCAACTTCAATAGPCR spo0A fragment
UPERMcgtggaagcttGTGCTCTACGACCAAAAGPCR MLSr gene
DSERMaggaagcttGTGAATGCGCAAAAGACATPCR MLSr gene
5′NSKOGGTGGGATAGTTCAAGGAATGPCR SKO1
3′NSKOCATCGTAACTCCCTTGGATACPCR SKO1
PIMPSEQTCCCAGTCACGACGTTGTAASequencing
SPOSEQ2GACCATGCAACTTCAATAGCSequencing
SEQ3SPOTACATCCATATCAAAAGGTTSequencing
SEQDSPOCGACAAAACTATTATTTATCSequencing
PTB-DOCTATTGGCTTTAAGAGTCCGCPCR ptb probe
PTB-UPGCTGTGGATGGAGTTAAGTCAGPCR ptb probe
THIOL-3ECATGATTTTAAGGGGGGTACCATATGCAPCR thl probe
THIOL-5BGTTATTTTTAAGGATCCTTTATAGCACPCR thl probe
5′SIGEGCAATGAGCTTAGAGAGCCTATPCR sigE-sigG probe
3′SIGGACTTCCATGGACTTCATAGCAPCR sigE-sigG probe
  • a Lowercase letters in the oligonucleotide sequences indicate nucleotide substitutions used to generate useful restriction sites near the termini of PCR products. Restriction sites are underlined.