TABLE 2

Primers used

NameSequencePurpose
PILRBSGGCTTTCCCCTTTCAATTAGGAGpilE verification
SP3ACCGGAACGGACGACCCCGpilE verification
CONSTF2TACCAAGACTACACCGCCCG454 sequencing
SmaClaICAAACCCTTAAAAGACAAGC454 sequencing
LACPFORGAGCGGATAACAATTTCACArecA6 verification
GcRecA-Rev2CAAAGCCGAAGAAACCGCrecA verification
GcRecA-ForATGCGATAATGACCGACCGrecA verification
GCRECA-REVAGATCTTTATTCTTCGGGTCGTTCGCrecA verification
ThrB-ForGACTTACCATGTGTTGTCGCthrB verification
ThrB-RevAGCCGATATTCTGAACTGGGthrB verification
RECO3GCATAATGTTTCCTTTTCTCTTCGrecO verification
RECO4TTCAGACGGCATTTCCACAACrecO verification
RDGC3TTCAGCAAATAATTCCCGACrdgC verification
RDGC4AGGGCGAACATCATGGCGrdgC verification
RUVBFOR2TGCCGTCTGAAACGCGCCGruvB verification
RUVBREV2CAAACGTCTGATAACAATGCCGruvB verification
ermCout1CAATTCTTATCTCTTTTCAATAGCrecB verification
ermCout2GAAGTAATAAAGTTTTGACTGTGrecB verification
RECB1ATTGCCGCCCTGTTTACGCrecB verification
RecJfor_N-HisAGCATACATATGTCAGTCAAAATCCAAACCrecJ verification
RecJrev_N-HisCGTCGCAAGCTTACGCCGCTTCCCAGTAGrecJ verification
RecN game primer SATGCTTCTAACACTTTCTTTGCGrecN verification
RecN3primeendAAATAAACTATTTTTCGACGCAAGrecN verification
RECGREVGTCCTGATTTTTGTTAATCCACrecG verification
RECG1FORCCGCCGGGGCTTGATTCCrecG verification
GCRECXREVTTAGAATTCTCAGCAGCTGTCTTCCCrecX verification
GCRECXFORGATCTTAATTAAATTTACGAAAACCTGCAArecX verification
Repfor_N-HisGAATTCCATATGATGAAACTCAATGCCCAArep verification
Reprev_N-HisTTAATCCGCCGGGCCGCCCTAGGGCACGTrep verification
RecQver_forACCGACCAACACCCTTACrecQ verification
RecQver_rev2TTAAACAGAGGCAATGCCGrecQ verification
pilCdownstreamCCATCTTTGGCGGTACCCTCGCTGpilC verification
PilCPLforGGCGGAGGTGGCGGGGCCpilC verification