TABLE 2.

Primers used in this study

Primera        Description
F1: ACGTACGTCATATGGAAAAATTCAGCAACATTGCGAAAmplifies 432-bp gonococcal Fur ORFb
R1: ACGTGGATCCTTAACGTTTGCCCTTGGCCTGACAGTC
F2: CGGGATCCACAGGCGAGGATAGGGTTTGTAmplifies 120-bp promoter fragment of gonococcal fur
R2: CCAAGCTTGACAGGGTAAAATACCGCTTA
F3: CGGGATCCGAATTCCTATCCGATTTGCCGAmplifies 100-bp promoter fragment of gonococcal rmp
R3: CCAAGCTTTTATTCCCTCATTAGATTTGTA
F4: CGGGATCCCACGGTTTGCCTATGAATGGAmplifies 100-bp promoter fragment of gonococcal tonB
R4: CCGGATCCGGGCATAATAATAGCAACAATTCC
F5: CGGATCCGTTCCCTTTGAGCCGGGGAmplifies 100-bp promoter fragment of gonococcal opa multigene family
R5: CGGATCCCGGCTCCTTATTCGGTTTGACC
F6: CGGGATCCCGGTAAGGGATAAGGATGCGGAmplifies 132-bp promoter fragment of gonococcal hemO
R6: CCGGATCCCCCGCTTAAAAATATAACGC
F7: CGGGATCCCAACTCAAGATGTAATGGATTGAmplifies 103-bp promoter fragment of gonococcal hmbR
R7: CGGGATCCCACAGATTTATTTGTACGGG
F8: CGGGATCCGGCAGAGTCGGCATCCTGAATGAmplifies 175-bp promoter fragment of hypothetical gonococcal Fe-S gene
R8: CCGGATCCTACTTTAAGTAATTGACCGTTGC
F9: CGGGATCCGAATCGGCGGCTCACGCATTCAmplifies 184-bp promoter fragment of gonococcal sod
R9: CCGGATCCCCGCCTCCATCGAATGCGGAG
F10: CGGGATCCCTTTTCAGACGGCATTTTTAmplifies 109-bp promoter fragment of gonococcal fumC
R10: CCAAGCTTCGTTTCTCCTTTTGAAATGT
F11: CGGGATCCCGCCTACGGATGAAGAAGAGCAmplifies 219-bp promoter fragment of gonococcal recN
R11: CCAAGCTTGGAATTCTACCGACAAAAGCAA
F12: CCGGATCCCGTGTTGGTGGTAAGATTGAAAAmplifies 193-bp promoter fragment of gonococcal secY
R12: CCAAGCTTGGCGCTTTCGTATAATTTAGC
  • a F, forward; R, reverse. Restriction sites are underlined.

  • b ORF, open reading frame.