TABLE 3.

Neisserial genes with putative Fur boxesa

GeneFunctionComparison with neisserial consensus (GATAATATAATAA-TTATCTTT)bNo. of nucleotides identicalBinding of Gc/Ec Furc
tonBEnergy transducerACAACAAATTATAAAAAATAGG13Yes/Yes
opaIntergonococcal adherenceTTCAACATCAGTGAAAATCTTT13Yes/Nod
furGlobal regulatorGATAATCATACGCTTAAGCGC12Yes/Yes
sodSuperoxide dismutaseTATAATAGAAGATTGCAATTT13Yes/Yes
hemOHeme oxygenaseAAAAATATCATTTGCGTTATATTT15Yes/Yes
hmbRHemoglobin receptorGTTAATTCATAATAAATTTTCTGA17Yes/Yes
secYPreprotein translocaseGAGATCTTAAGAAACGTCTTT13Yes/Yes
recNRecombination proteinAAAAATCTTAGTTATAATTCGTAT14Yes/Yes
fumCFumarate hydrataseGCGAATCACTCTTATTCACATTT13Yes/Yes
Hypothetical geneTGTAATGATAATTATTATCGAA15Yes/Yes
  • a Partial listing of Neisseria genes containing putative Fur binding sequence (Fur box) in the promoter/operator. Consensus homology was determined by comparison with the previously published 21-bp gonococcal Fur box consensus (9).

  • b Identical nucleotides are in boldface type.

  • c Binding of gonococcal (Gc) and E. coli (Ec) Fur proteins to the promoter regions of these genes was determined by EMSA with 500 ng of Fur protein.

  • d opaH, opaI, and opaE do bind to E. coli Fur.