TABLE 1.

Strains, plasmids, and primers

Strain, plasmid, or primerPhenotype, description or sequenceSource, reference, or description
Strains
    CF1648MG1655 wild type52
    CF1652MG1655 ΔrelA251::kan52
    CF1693MG1655 ΔrelA251::kan ΔspoT207::cat52
    CF7968MG1655 Δlac (rph+)Cashel lab
    CF9084CF7968 ΔrelA255::catCashel lab
    CF9992CF9084 ΔrelA255::cat ΔdksA::tetThis work
    TE8114MG1655 ΔdksA::tetThis work
    PK201MG1655 ΔdksA::kan25
    TE6406MG1655 ΔlacX74 trp::put::kanR-rpoS-lac (fusion A)11
    TE2680F λ IN(rrnD-rrnE)1 Δ(lac)X74 rpsL galK2 recD1903::Tn10d-Tet trpDC700:: putPA1303::(Kans-Camr-lac)14
    TE6608TE2680 trp::put::kan Ptac-rpoS-lacΔ2 (fusion J)14
    TE6798TE2680 trp::put::kan Ptac-rpoS-lac (fusion F)14
    TE6987TE2680 trp::put::kan PlacUV5c-rpoS-lac (fusion K)14
    TE6989TE2680 trp::put::kan PlacUV5-rpoS-lacΔ2 (fusion M)14
    CF9993/CF10003CF9084/CF9992 trp::put::kan-rpoS-lac (fusion A)/ΔdksAThis work
    CF9995/CF10005CF9084/CF9992 trp::put::kan Ptac-rpoS-lacΔ2 (fusion J)/ΔdksAThis work
    CF9997/CF10007CF9084/CF9992 trp::put::kan Ptac-rpoS-lac (fusion F)/ΔdksAThis work
    CF9999/CF10009CF9084/CF9992 trp::put::kan PlacUV5c-rpoS-lac (fusion K)/ΔdksAThis work
    CF10001/CF10011CF9084/CF9992 trp::put::kan PlacUV5c-rpoS-lacΔ2 (fusion M)/ΔdksAThis work
    CF10013/CF10018CF9084/CF9992 trp::put::kan rpoS-lac (fusion A) pLB8/ΔdksAThis work
    CF10014/CF10019CF9084/CF9992 trp::put::kan Ptac-rpoS-lacΔ2 (fusion J) pLB8/ΔdksAThis work
    CF10015/CF10020CF9084/CF9992 trp::put::kan Ptac-rpoS-lac (fusion F) pLB8/ΔdksAThis work
    CF10016/CF10021CF9084/CF9992 trp::put::kan PlacUV5c-rpoS-lac (fusion K) pLB8/ΔdksAThis work
    CF10107/CF10022CF9084/CF9992 trp::put::kan PlacUV5c-rpoS-lacΔ2 (fusion M) pLB8/ΔdksAThis work
Plasmids
    pALS13Ptac-relA′ (RelA 1-455) Apr49
    pLB8PBAD-relA′ (RelA 1-394) AprThis work
    pJK537dksA in pBR322 Apr25
    pMMKatF3rpoS39
    pGN66bolA promoter plasmid41
Primers
    DG62GGGTAGGAGCCACCTTATGAGTCAGAATACrpoS probe, −16 to +14 with AUG +1
    DG63GGATCCTAATACGACTCACTATAGGGAGGGGGTAAAGCGAGTC GCGTCCAACACACGCTrpoS probe, 154 to 183 with AUG +1, pT7 underlined
    DG22GCGGGATCCTGCTGTGGCAGTbolA p2 probe, −364 to −384 with AUG +1
    DG71GGATCCTAATACGACTCACTATAGGGAGGGCGATCGCTGACAG ACAACbolA p2 probe, 153 to 174 with AUG +1, pT7 underlined