TABLE 1.

Oligonucleotides used in these studies

PrimerSequence (5′ to 3′)Use for PCR
ORFD-1ACGATAGGGTAATATCAAAAAGGcp32-1
ORFD-2AGTTCATCTAATAAAAATCCCGTGcp32-1
E-506AACTTTTTTTTACATCTTCACCACB31 erpK promoter
E-513CTGTTTGTTAATATGTAATAGCTGB31 erpK promoter
PC-29TCTCTAATTCTTCTTGCAATTAGTTGospC promoter
PC-40TCCTGAATTATTACAAGATATAAATAospC promoter