TABLE 1.

ICE6013 integration sites in diverse S. aureus strains

StrainMultilocus sequence typeaSite and descriptionbJunctionc
Genome sequenced
    0582ST2391; intergenic, adjacent to SAR2664 homologTCTTTTTTATTGGCAGTGTACACCACCATTAAATTTAA
    MRSA252ST362; intergenic, adjacent to SAR1285TTTTATAGTATGGCAGTGTACACCACCTATTAAAAGTT
    COLST2503; intergenic, adjacent to SACOL1572ACATTTTAAATGGCAGTGTACACCACCAATTAAAAACA
    EMRSA15ST224; intragenic, within SA1208 homologCTTTCTTTTAAGGCAGTGTACACCACCTAATAAAGAAC
    TCH1516ST85; intragenic, within USA300HOU_0624TTTAATTAAATGGCAGTGTACACCACCAATTAAAATCA
    FPR3757ST83; intergenic, adjacent to SAUSA300_1476ACATTTTAAATGGCAGTGTACACCACCAATTAAAAACA
This study
    HDG2ST2391; intergenic, adjacent to SAR2664 homologTCTTTTTTATTGGCAGTGTACACCACCATTAAATTTAA
    EMRSA16ST362; intergenic, adjacent to SAR1285 homologTTTTATAGTATGGCAGTGTACACCACCTATTAAAAGTT
    C437ST256; intragenic, within SAR1491 homologCTATTTTATCAGGCAGTGTACACCACCTCAAAAATAAT
    C316ST497; intragenic, within SACOL2583 homologACCTATTATATGGCAGTGTACACCACCTATTCAATTAT
    D410ST278; intragenic, within SACOL1583 homologCCTTTTTAATTGGCAGTGT…no data
9; putative tandem integrationACACCACCAATGGCAATGT…no data
    D22ST18210; intergenic, adjacent to SAR2037 homologACACATCATAAGGCAGTGT…no data
11; intragenic, within SAR0278 homologTTTATTCTTATGGCAGTGT…no data
  • a The clonal background.

  • b Each unique integration site is given a unique number.

  • c Left junction…right junction. Three-base-pair direct repeats are underlined, and 8-bp imperfect inverted repeats are italicized.