TABLE 1.

Strains, plasmids, and primers used

Strain, plasmid, or primerGenotype or descriptionReference(s) or source
E. coli DH5αφ80 Δ(lacZ)M15 Δ(argF-lac)U169 endA1 recA1 hsdR17 (rK mK+) deoR thi-1 supE44 gyrA96 relA148
S. aureus strains
    8325-4Wild-type strain cured of prophagesLab stock
    RN4220Restriction-deficient transformation recipientLab stock
    MJH499rsbU rsbV rsbW sigB::pMAL30 integrant in RN4220This study
    MJH500rsbU rsbV rsbW sigB::pMAL30 integrant in 8325-4This study
    MJH501Functional rsbU derivative of RN4220 rsbU+This study
    MJH502SH1000 rsbU+ sigB::tet
    SH1000Functional rsbU derivative of 8325-4 rsbU+This study
    SH1001SH1000 agr::tetThis study
    SH1002SH1000 sarA::kanThis study
    PC6911agr::tet9
    PC1839sarA::kan9
    PC400sigB::tet10
    MJH0068325-4 katA::pAZ106 katA+30, 31
    MJH506SH1000 katA::pAZ106 katA+This study
    MJH606SH1000 katA::pAZ106 katA+ sigB::tetThis study
    LES078325-4 sspA::pAZ106 sspA+This study
    LES08SH1000 sspA::pAZ106 sspA+This study
    PC1618325-4 sarA::pAZ106 sarA+9
    JLA311SH1000 sarA::pAZ106 sarA+This study
    PC40308325-4 sarA::pAZ106 sarA+ sigB::tet10
    JLA313SH1000 sarA::pAZ106 sarA+ sigB::tetThis study
    SH101F78325-4 agr (RNA III)::pAZ106 agr+23
    JLA341SH1000 agr (RNA III)::pAZ106 agr+This study
    PC6048325-4 agr (RNA III)::pAZ106 agr+ sigB::tetThis study
    JLA343SH1000 agr (RNA III)::pAZ106 agr+ sigB::tetThis study
    PC6008325-4 agr (RNA III)::pAZ106 agr+ sarA::kanThis study
    JLA345SH1000 agr (RNA III)::pAZ106 agr+ sarA::kanThis study
    PC6028325-4 agr (RNA III)::pAZ106 agr+ sigB::tet sarA::kanThis study
    JLA347SH1000 agr (RNA III)::pAZ106 agr+ sigB::tet sarA::kanThis study
    PC3228325-4 hla::pAZ106 hla+9
    JLA371SH1000 hla::pAZ106 hla+This study
    PC40448325-4 hla::pAZ106 hla+ sigB::tetThis study
    JLA373SH1000 hla::pAZ106 hla+ sigB::tetThis study
    PC32218325-4 hla::pAZ106 hla+ sarA::kanThis study
    JLA375SH1000 hla::pAZ106 hla+ sarA::kanThis study
    JLA3768325-4 hla::pAZ106 hla+ sigB::tet sarA::kanThis study
    JLA377SH1000 hla::pAZ106 hla+ sigB::tet sarA::kanThis study
Plasmids
    pAZ106Promoterless lacZ erm insertion vector30
    pMAL303-kb OL-80-OL-81 rsbU rsbV rsbW sigB PCR fragment in pAZ106This study
    pLES21.15-kb OG-15-OG-16 sspA PCR fragment in pAZ106This study
Primersa
    OL-15AATTGGATCCGACCACAATGCCCAATACAACC
    OL-78TATCTACCAATCTTTGATAATCTCGATAAC
    OL-79GCTCTAGAGTTCAAGACATTAGATG
    OL-80GTGAGGATCCGAAGCTTTTCCGATAGAGTGTGAAG
    OL-81GCTTGAATTCATACGTCTCGGAACATGTACACTCC
    OL-177ACACTGCAGGAATGGTAACATGGTAATAAT
    OG-15CCGTCTAGAGTGCCAATGTTCCAGCTCAAATAGC
    OG-16CCGGGATCCGAATCTTAGGTGTTTGCTGTTTGC
  • a Restriction sites are underlined.