TABLE 2.

Primers used for site-directed mutations

MutationPrimer sequence
ForwardReverse
S206AGATTTTAAATTTGATAATGTTGTGATTGCAACTTCAGTTGGAACAGGACTTGGAGCGCTCCAAGTCCTGTTCCAACTGAAGTTGCAATCACAACATTATCAAATTTAAAATC
S342AGATGGTAGAGATATCAATATAGCTGGAACCAATCTTAGTGCTATAGGCCTATAGCACTAAGATTGGTTCCAGCTATATTGATATCTCTACCATC
S347AGAGATATCAATATAAGTGGAACCAATCTTGCTGCTATAGGTATGGGTACAACAGCTGTTGTACCCATACCTATAGCAGCAAGATTGGTTCCACTTATATTGATATCTC
T393ACTTATAAAGGTGGTGGAAAATTTGTTTTTGCTCAAAATGTAAGTTCAATTTCTGCATTTATGAGTGCGCACTCATAAATGCAGAAATTGAACTTACATTTTGCGTAAAAACAAATTTTCCACCACCTTTATAAG
S397AGGAAAATTTGTTTTTACTCAAAATGTAGCTTCAATTTCTGCATTTATGAGTGCGTGCACTCATAAATGCAGAAATTGAAGCTACATTTTGAGTAAAAACAAATTTTCCC
S400AACTCAAAATGTAAGTTCAATTGCTGCATTTATGAGTGCACAAGGTTCGAACCTTGTGCACTCATAAATGCAGCAATTGAACTTACATTTTGAGT
S404AGTAAGTTCAATTTCTGCATTTATGGCTGCACAAGGTTCAGGATTTTCTAGCTAGAAAATCCTGAACCTTGTGCAGCCATAAATGCAGAAATTGAACTTAC
S408ACAATTTCTGCATTTATGAGTGCACAAGGTGCAGGATTTTCTAGAGGTTCAGGATTTTCTGCAGAAAATCCTGAACCTCTAGAAAATCCTGCACCTTGTGCACTCATAAATGCAGAAATTG
S417AGGATTTTCTAGAGGTTCAGGATTTGCTGTGGGTAGTGGTAAAAATTTATCTGTTGGATTGAGCTCAATCCAACAGATAAATTTTTACCACTACCCACAGCAAATCCTGAACCTCTAGAAAATCCTGAACC
S425ACTGTGGGTAGTGGTAAAAATTTAGCTGTTGGATTGAGTCAAGGAATACAAATTATTTCAAGTGCGGCTTCGAAGCCGCACTTGAAATAATTTGTATTCCTTGACTCAATCCAACCGATAAATTTTTACCACTACCCACAG
S429AGTGGGTAGTGGTAAAAATTTATCTGTTGGATTGGCTCAAGGAATACAAATTATTTCAAGTGCGGCTTCAATGCATTGAAGCCGCACTTGAAATAATTTGTATTCCTTGAGCCAATCCAACAGATAAATTTTTACCACTACCCAC
S436ATCTGTTGGATTGAGTCAAGGAATACAAATTATTGCAAGTGCGGCTTCAATGAGCAATACTTATGTTGTTTCGAAACAACATAAGTATTGCTCATTGAAGCCGCACTTGCAATAATTTGTATTCCTTGACTCAATCCAACAGA
S440AGGAATACAAATTATTTTCAAGTGCGGCTGCAATGAGCAATACTTATGTTGTTTCGAAACAACATAAGTATTGCTCATTGCAGCCGCACTTGAAAATAATTTGTATTCC
S448AGCTTCAATGAGCAATACTTATGTTGTTGCAGCAGGTTCAGGATTTTCTTCTGCAGAAGAAAATCCTGAACCTGCTGCAACAACATAAGTATTGCTCATTGAAGC
S451AGAGCAATACTTATGTTGTTTCAGCAGGTGCAGGATTTTCTTCTGGCTCAGGAAATTCTCAATTTGCGCAAATTGAGAATTTCCTGAGCCAGAAGAAAATCCTGCACCTGCTGAAACAACATAAGTATTGCTC
S454ACTTATGTTGTTTCAGCAGGTTCAGGATTTGCTTCTGGCTCAGGAAATTCTCAATTTGCAGCCCTTAAAACGTTTTAAGGGCTGCAAATTGAGAATTTCCTGAGCCAGCAGAAAATCCTGAACCTGCTGAAACAACATAAG
S457AGTTGTTTCAGCAGGTTCAGGATTTTCTTCTGGCGCAGGAAATTCTCAATTTGCAGCCCTTAAAACTACTGCGCAGTAGTTTTAAGGGCTGCAAATTGAGAATTTCCTGCGCCAGAAGAAAATCCTGAACCTGCTGAAACAAC
S460AGGTTCAGGATTTTCTTCTGGCTCAGGAAATGCTCAATTTGCAGCCCTTAAAACGTTTTAAGGGCTGCAAATTGAGCATTTCCTGAGCCAGAAGAAAATCCTGAACC
T481AGCTAATACAACTGATGAGACTGCAGGTGTAACCGCTCTTAAAGGTGCAATGGCGGTTATGGATATAGCGCTAATACAACTGATGAGACTGCAGGTGTAACCGCTCTTAAAGGTGCAATGGCGGTTATGGATATAGC