TABLE 3.

Short direct repeats flanking CREE in the three neisserial genomes

Neisserial strainNo. of short direct repeats upstreamCREE copya (TATAG***CTATA)No. of short direct repeats downstream
TATATTATATATAGTAATATATACTATA
N. meningitidis Z24911221027010631
N. meningitidis MC581621126117420
N. gonorrhoeae FA109083101023220
  • a The copy number of CREE includes simple CREE contained inside complex CREE in order to show the flanking sequence features of all CREE.