TABLE 1.

Oligonucleotide primers used in this studya

PrimerSequence (5′ → 3′)Positionb
P1tcatgaggatccctAgTTAcTGgTAGTGTTTTAT755-736
P2GTTTTACGCGTATGACAGGCTCCGGAAGACGGTTGTTGCGCACGTATTCGGTGAACGCACT ATGGCGACGCTGGGGCGTCTTATGAGCCTGCTGTCACCCTTTGACGTGGTGATATGGATG ACGGcTGGCTGG426-558
P3GGCAGTGACGTCATCGTCTGCGCGGAAATGGcCGAACAGTG349-389
P4GTTTTACGCGTATGACAGGCTCCGGAAGACGGTTGTTGCGCACGTATTCGGTGAACGCACTA TGGCGACGCTGGGGCGTCTTATGAGCCTGCTGTCACCCTTTGcCGTGGTGATAT426-541
P5CAGTCGGTAACCTCGCGCATACAGCCGGGCAGTGcCGTCATCG322-374
P6GTTTTACGCGTATGcCAGGCTCCG426-449
P7GTTTTACGCGTATGACAGGCTCCGGAAGACGGTTGTTGCGCACGTATTCGGTGCACGcACTAT GGC426-491
P8gggggctcgagTGAGGTGCTCCAATGGCTTCTGTTTCTATCAGCTGTCCCTCCTGTTCAGCTACTGcC GGGGTG44-106
P9CGCAGACGATGACGTCACTGCCCGGCTG370-345
P10CCGGGCAGTGACGTCATCGTCT346-367
P11ggggatccCTTATTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTCATGCAGCgC CACCG754-695
P12ggggatccCTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGgCATGCAGC754-702
P13CTGTATGcATCCCGCCTGAA562-581
P14GCGGGATgCATACAGCGGCCAGCCA576-556
P15GCGAATTGcGCGGCATAACC618-637
P16TGCCGCgCAATTCGCTGCGT632-617
P17GGCAGTGACGTCATCGTCTGCGCGGcAATGGA349-380
P18GGCAGTGACGTCATCGTCTGCGCGGAAATGGACGCACAGTGG349-390
P19GCGCGAGGTTACCGACTGCGGCCTGAGTTTcTTcAAATGGCGGAAAATCGTGTTGAGGCCAA CGCCCATAATGCGGGCGGTTGCCCGGCATCCAACGCCATTCATGGCCATAGCAaTGAT339-221
P20gggggctcgagTGAGGTGCTCCAaTGGCT44-61
P21tcatgaggatccctAgTTAcTGgTAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTtATGC755-706
P22tcatgaggatccctAgTTAcTGgTAGTGTTTTATGTTCAGATAATCCCGATGACTTTcTCATGC755-706
P23GCAGTGACGTCATCGTCTGCGCGGAAATGaACGAA350-384
P24GCAGTGACGTCATCGTCTGCGCGGAAATGGACcAACAG350-387
P25TGTTTTACGCGTATaACAGGCTCCGGAAGAC425-455
P26CTGGCCGCTGTATGAATCCC555-574
P27GTGCAGCTTTCCCTTCAGGCGGGATTCATACAGCGGCCAGCCATtCGTCA594-545
P28GTGCAGCTTTCCCTTCAGGCGGGATTgATACA594-563
P29AGATTCAGGTTATGCCGCTCAA644-623
P31GCAGTGACGTCATCGTCTGCGCGGAAATGGAaGAACAG350-387
P32GCAGTGACGTCATCGTCTGCGCGGAAATGGACGAtCAGTG350-389
P33TGTTTTACGCGTATGAaAGGCTCCGGAAGAC425-455
P34GTGCAGCTTTCCCTTCAGGCGGGATTCATACAGCGGCCAGCCtTCCGTCA594-545
P35CGCAGCGAATTGAtCGGCATAACC614-637
  • a Primers were used for construction of pSIN plasmids (see Materials and Methods). Lowercase letters indicate additional nucleotide sequences with a restriction site or nucleotides altered to introduce mutations.

  • b Positions are indicated by coordinates for IS1.