TABLE 2.

PCR primers used in this study

PrimerSequencea
5′kan783 (NcoI)TATCCATGGAGGTGATAGGTAAGATTATA
3′kan783 (MluI)TTAACGCGTCTAGAGTCGATACAAATTC
5′kan783 (ClaI)ATAATCGATAGGTGATAGGTAAGATTATAC
3′kan783 (ClaI)ATAATCGATTAAAACATCAGAGTATGGACA
yplP −455 (EcoRI)ATAGAATTCTTTCATTTTATGATAAGCCCC
yplP + 1475 (EcoRI)TATGAATTCTCAGTGAAGCATATAAAGGTT
ylaG_P1AACAGCGGAGAAAAATTGTTCAAGTGCAA
ylaG_P2CGAGCTCGAATTCGTAATCATGGTCATATCATATTATATCACACATCCTCTTTAAAAGC
ylaG_P3GTATAATCTTACCTATCACCTCAAATGGTTGAATTTGAAAAGATAGAACCCGTACGTTTA
ylaG_P4ATCCGGTAAGAGGTATACTGGATGAATTA
5′des_SondeTGATTCAGCTTTTAAACACGT
3′des_Sonde + T7 TAATACGACTCACTATAGGGAGAATCTTCAAAGGTATGCT
5′ylaG_SondeCAATGGACTCTAATGATCTTG
3′ylaG_Sonde + T7 TAATACGACTCACTATAGGGCGTCAAGCTTCATAAGAGAAA
5′yplP_SondeAGCTTCCTGTCTTAATAACAG
3′yplP_Sonde + T7TAATACGACTCACTATAGGGTTGCTGTGTTCAGAAATGATC
  • a Cutting sites are in boldface. T7 polymerase promoters are underlined.