TABLE 2.

PCR primers used in this study

PrimeraSequence (5′→3′)b
invA-P1TGAAAAGCTGTCTTAATTTAATATTAACAGGATACCTATAGTGTAGGCTGGAGCTGCTTC
invA-P4ATATCCAAATGTTGCATAGATCTTTTCCTTAATTAAGCCCATGGGAATTAGCCATGGTCC
invA-5′PCRGCAGAACAGCGTCGTACTAT
invA-3′PCRCGGAACGAACTAATTCAGCG
ompC-P1ATAAAAAAGCAATAAAGGCATATAACAGAGGGTTAATAAC GTGTAGGCTGGAGCTGCTTC
ompC-P4AAAAAGGGCCCGCAGGCCCTTTAGCAACATCTTTTGCTGA ATGGGAATTAGCCATGGTCC
ompC-5′PCRGTTAACCAGTAAGCAGTGGC
ompC-3′PCRTACGCCGGAATAAGGCATGA
ompD-P1GTTGAGGAAACACGCTAAGAAAATTATAAGGATTATTAAAGTGTAGGCTGGAGCTGCTTC
ompD-P2GCCCTGAAAGGACTGGCTTTGTATTCAGACTACAACAAAAATGGGAATTAGCCATGGTCC
ompD-5′PCRAAACGCCTCGTTTAACAATG
ompD-3′PCRTACATCAAGAGAAAAAGCCA
ompD-3xFLAG-5′ACCGACAACATCGTTGCTGTTGGTCTGAACTACCAGTTC GACTACAAAGACCATGACGGT
ompD-3xFLAG-3′CCAGTGAACGTCTGCACGGCATACTCCTTATGACCGAGTC CATATGAATATCCTCCTTAG
ompF-P1GCAGGTGTCATATAAAAAAACCAATGAGGGTAATAAATAGTGTAGGCTGGAGCTGCTTC
ompF-P4AAGTCCTGTTTTTGAGGCATAAAACAAAGGGGTCTGCTGAATGGGAATTAGCCATGGTCC
ompF-5′PCRCGGAATTTATTGACGGCAGT
ompF-3′PCR GAGATAAAAAAACAGGACCG
ompN-P1CAATCTTTTGCAAATAAGTTAAGTTTTTAAGGATAAAAAA GTGTAGGCTGGAGCTGCTTC
ompN-P4GCCCGCCGAAACGGCGGGCTTGAGAAGAATTAATGAATAA ATGGGAATTAGCCATGGTCC
ompN-5′PCRTCAACGAATCTGTAGAAGTT
ompN-3′PCRGTGGTGATGAAAAAAGAAAA
phoE-P1TCCCGACAAATCATAGCGCGTAATTAAAACAGGAATGGAAGTGTAGGCTGGAGCTGCTTC
phoE-P4ATGCCTGATGGCGCAGCGCCATCAGGCACAATGCGACTTAATGGGAATTAGCCATGGTCC
phoE-5′PCRTTCCTGTTTTTTACCGGGTT
phoE-3′PCRGTCGGCATAACCCTGCTGCC
pmrA-P1CCGCAGATGATATTCTGCAACCGTGCAGGAGACTAAGCGA GTGTAGGCTGGAGCTGCTTC
pmrA-P4GAAGGGTCATCGCTCTTCGCTGAAAACGCATCAGGCTCAC ATGGGAATTAGCCATGGTCC
pmrA-5′PCRACAAACGACGTATTACCAGG
pmrA-3′PCRTGTCAGCATTAAACGCTGGC
STM1530-P1TTGCGGAAAGTCCAAAAATAAGACAAATAAGGCATATAAAGTGTAGGCTGGAGCTGCTTC
STM1530-P4AAGGAGGGTATCCCTAAACTGTCTTAATCAGCAAGTTTTAATGGGAATTAGCCATGGTCC
STM1530-5′PCRGACAGTTCCGCGAGCAGGCT
STM1530-3′PCRCAGTGACACAGTTTTGGGAA
yddG-P1AACGCTAATAGGGCTTGTTGCCATCGTTCTGTGGAGCACG GTGTAGGCTGGAGCTGCTTC
yddG-P4GCGGGTCGATTTAATATCAATATCGGCCCGCCCGTCGCTA ATGGGAATTAGCCATGGTCC
yddG-5′PCRAGCATGACATCACAAAAAGC
yddG-3′PCRATGAAGAGTGTCAAGGTACA
ydeI-HA-5′GCGAAGGAACCGCTTGTTCGCGTGAACCGACTGCAAAAATATCCGTATGATGTTCCT
ydeI-HA-3′CGCTTTTACAAGACCCATGGTATCAGGCCAGCCGCGTGCCCATATGAATATCCTCCTTAG
ygiW-P1ATTAAATGGATCTGAAACGACATGAAAGGGAAAAGTAATCGTGTAGGCTGGAGCTGCTTC
ygiW-P4GGGCGGCTGTGAATCCTGACCGATCTTGCGCAATGTGGGA ATGGGAATTAGCCATGGTCC
ygiW-5′PCRAAGTTGTTAAGGATTACCTT
ygiW-3′PCRTGTGGCCTATTCTGCCCACC
  • a The primer name indicates the gene or operon deleted or the epitope tag, followed by the primer binding site or epitope tag. P1, P2, and P4 indicate priming sites in pKD3 or pKD4 plasmids from Datsenko and Wanner (15). 5′PCR and 3′PCR refer to PCR primers used to screen deletion mutants and correspond to serovar Typhimurium genomic sequences. Primer families are divided by lines of space.

  • b Underlined sequences denote priming sequences for P1, P2, or P4 sites (15) or epitope tag sites in pSU315 (HA) or pSUB11 (3xFLAG) for 5′ epitope tag primers (65).