TABLE 2.

Oligonucleotide primers used in this work

PrimerSequenceaTarget/use
1GAGACGGATCCGTTTGCACAACTACGGGCTTACloning of the 5′ terminus of HP2 upstream of attP (BamHI)
2GAGACCGCTCGAGCGGATGGCTTGCGGAAGTTTATGCloning of the 5′ terminus of HP2 upstream of integrase (XhoI)
3GAGAGGAAGATCTCCCGGTCAAAATCTACCCGAAA3′ terminus of HP2 (BglII)
4GAGACGGAATTCCGCTTTAGTTTGCTCCGCAACCCloning of the 3′ terminus of HP2 at position 29,742 (EcoRI)
5GCTGCTCTACCGACTGAGCTACreation of a PCR probe to the early genes of HP1 + HP2
6AGACGGTGAGGCACGTTTAGCreation of a PCR probe to the early genes of HP1 + HP2
7AAGGGGGAAATAATGGCAACCloning of HP2 genes in the pR promoter group
8AAAGGATTGTTATTGCCCCCloning of HP2 genes in the pR promoter group
  • a Sequences run 5′ to 3′, with restriction sites listed in target use underlined.