TABLE 2.

Sequences of primers used in this study

PrimerDNA sequence (5′→3′)a
CtxF1GCTCTAGATCGAGTCAGAGCAATCCGAG
CtxR1GAAGATCTGCATATGAAAATGATGATAA
VieSF4GCGAAAAGGAAATGGTATGAA
VieSR4AGCTGTTTTTTGATCATAATACTGCAATGGTGACTGT
VieSF5CACCATTGCAGTATTATGATCAAAAAAACAGCTCAGTG
VieSR5TGATACTGATGAAGCCACTGT
AHTHF1GCAGCTTTCCGTCAACATC
AHTHR1CTCTCGGTACTACTCTTCTTGTTGCGCCTGT
AHTHF2CAAGAAGAGTAGTACCGAGAGTTATGGCTG
AHTHR2TCCCCAACCGATAAGCAC
F18AATTGAGCAGTGTGGCTTGCAT
AHTHR3TGTTCCGATTCCGCTTGTC
F13TCGTCGTCAAAGCGAATACTT
R14CTGGTGCGGGCAGTCATAGAGT
F36CAACAACAGAGTGGTTTG
VieSR1ACATGCATGCTCTTAGCTTGAGCTTCAGGC
LSABFTAGTCAGGTACCAGCAGTAATTGGACGAGCGAAAAGG
LSABRTAGTCAGCATGCTTCAGAACAAAACCGAGGCAATG
CTAFCTGTTAAACAAAGGGAGCATT
CTARGTGGGCACTTCTCAAACTAAT
CTBFATGCACATGGAACACCTCAA
CTBRGCATGAGGCGTTTTATTATTC
RpoBFCAGTTTGGGTCACTTATCAGC
RpoBRATTGGAAATACAGAACGAAAA
ToxTFTTCAATTATCTTACTCAA
ToxTRACAAATATCTGCCCAACG
SP6GCACCCCAGGCTTTACAC
T7GGGTTTTCCCAGTCACGA
  • a Restriction enzyme sites are underlined.