TABLE 2.

Oligonucleotides

NameSequence (5′-3′)aUse and/or description
AP24cgactagtctagaTTAAGGCTGAGTTTGTTTGRandom mutagenesis with AP54; XbaI
AP54cgagaggaattcaccATGAGTAAAGCCAGACGTTGGGpGS108Δ177-191 construction, with AP172 and random mutagenesis with AP24; EcoRI
AP149atatacatATGAGTAAAGCCAGACGTTGpET30-lptC-H construction, with AP150; NdeI
AP150cgcgcaggtaccAGGCTGAGTTTGTTTGTTTTGpET30-lptC-H construction, with AP149; KpnI
AP164GTCTATAACCCAGAAGTGGCACTAAGCTATCGpGS108G56V construction, with AP165
AP165CGATAGCTTAGTGCCACTTCTGGGTTATAGACpGS108G56V construction, with AP164
AP166cgagatggatccATGGCCGAAAAAGACGATACpQEsH-lptC construction, with AP167; BamHI
AP167cgagatctgcagTTAAGGCTGAGTTTGTTTGpQEsH-lptC construction, with AP166; PstI
AP168CTCGTCACGTTATACAGAACAACATTTAACTCpGS108G153R and pGS103G153R construction, with AP169
AP169GAGTTAAATGTTGTTCTGTATAACGTGACGAGpGS108G153R and pGS103G153R construction, with AP168
AP172gtgatcacatctagatcagtggtggtggtggtggtgTTCAATCAGCTCGGCGTTCpGS108Δ177-191 construction, with AP54; insertion of C-terminal His6 tag into LptCΔ177-191; XbaI
  • a Uppercase letters, E. coli genomic sequence; underlined lowercase letters, restriction sites; boldface letters, codons mutated by site-directed mutagenesis.