Table 2.

Primers and plasmids used in this study

Primer or plasmidSequence or genotype
Primer
    349 rapPcompF EcoRVAGGAGGATATCTTCATCCGGAGACTATTTATGAACAA
    350 rapPcompR BamHICTCCTGGATCCTTAGGTGGTAGCACCATTCTTGCA
    amyD forCTGCTTTGCTCTCCGTTCTGGTCT
    amyD revCATTAATAGGGCTGATGCCGAAGA
    fadA for2CGTTTGGTACAGAGGTTGATGAAG
    fadA rev2GGAACTTGCGACATGGATTCTGCT
    narG for2GGAAGGAGTGAACTCTCATGAAGA
    narG rev2CACGTATGGATATTTCACACGGAG
    ykoP forCGAGTCAGGCTGACGAAGTACAA
    ykoP revTGCTGACCGAGGCATCAGTCTTT
    degQ forCAGGAAACGCCAAGAATCGCATAT
    degQ revGACTTGTTTCCAAGTCTTTTTCACG
    swrA forGTTCGAATTCCTTAAAGAGATTATGGATCATAAGTCACAT
    swrA revGTTCGGATCCATGGCTTGGATATCCTCAGGAGAGT
    epsC forGCTGTGTATCACACGATGTTCTTC
    epsC revCCTCTTCTGGATTGTGTTCCAT
    epsC BamHII pMADGTTCGGATCCGATGTTCTTCCGTCTGTTAACCGC
    epsC EcoRI pMADGTTCGAATTCTCATTGCCGGATGTGTTACTGTC
Plasmid
    pDP105amyE::PrapP-rapP phrP cat amp