Table 1

Sequences of primers used in this study

Target and primer nameSequencea
escA deletion mutant
    ESCA-01FCGGGTACCAAAAGCGCGTATTGGTGC
    ESCA-01RCGGCTAGCTAAAATTCTGTCCAACATATTCA
    ESCA-02FTTTGCTAGCAAGGAACATTACTTTGACTAGCA
    ESCA-02RCAGAGCTCTACGGTTGCTAAAGGGTTATTAA
pEscA (pCR2.1-TOPO)
    EscA-F1AGAAGCTTCGAAAAAACGATTGAAAGCC
    EscA-2HA-RAACTCGAGGTCAAAGTAATGTTCCTTTATGG
Δ19EscA (pCR2.1-TOPO)
    Δ19EscA-FAAAGCTTAGCGAACCGATTGAGAG
pEscA (pACYC184)
    EscA-F2CTGGATCCAACAAAGCACCAAAGATATC
    EscA-HSV-R1AGAAGCTAGCGTCAAAGTAATGTTCCTTTATGG
    EscA-HSV-R2GGTCGACTCAATCCTCGGG
pEscC (pCR2.1-TOPO)
    pEscC-FCCAAGCTTGTTTTCTGATATAGGACG
    pEscC-2HA-RGGCTCGAGTTCGCTAGATGCAG
Δ21PhoA-2HA (pMAC2)
    Δ21PhoA-FGTACGGTACCATTAAAGAGGAGAAATTAACTGTGCGGACACCAGAAATGCC
    PhoA-RTTAAGCGTAATCTGGAACATCGTATGGGTATTTCAGCCCCAGAGCGGC
    HA-RTAGAGCTCTTAAGCGTAATCTGGAACATCGTA
EscA19PhoA-2HA (pMAC2)
    EscA19PhoA-F1GTTGGACAGAATTTTATCTATTCGTAAAAGCAGAGCGAACCGATTGAGAGAATCACGGACACCAGAAATGCCTGT
    EscA19PhoA-F2GTACGGTACCATTAAAGAGGAGAAATTAACTATGTTGGACAGAATTTTATCTATTCG
  • a Restriction sites are underlined.