Table 2

Primers used in this study

Primer usePrimer name (sequencea)
In-frame deletion of nla28S
    nla28S upstream 700 bpZS92F (GGATGTCCGTGGGGAGAAACTCCGCAGTTGG)
ZS92R (CGACGAGGATGCGGGCTGAGCGCCGTTCCTCTATCACGGGGCC)
    nla28S downstream 700 bpZS93F (GGCCCCGTGATAGAGGAACGGCGCTCAGCCCGCATCCTCGTCGTG)
ZS93R (CCGCTGGCCTCCTCGAAGACGCCTCGCCGC)
Cloning of nla28S, nla28, envZ, and ompR
    nla28S-cytZS108F (GCGCCGGGATCCCGCGTCACCTCGCTGCTCAAG)
ZS108R (GGGCGGGAATTCTCATGTTCCGACCTTGCGCATTTC)
    nla28ZS109F (GCGCCGGGATCCAGCTCAGCCCGCATCCTC)
ZS109R (GGGCGGGAATTCTCACGACTCGGCCTCCGGGGCCTC)
    envZ-cytZS134F (GGCCGCCATATGGCGGATGACCGCACGCTGCTG)
ZS134R (GCGCCGAAGCTTCCCTTCTTTTGTCGTGCCCTGC)
    ompRZS135F (GGCCGCCATATGCAAGAGAACTACAAGATTCTGGTG)
ZS135R (GCGCCGAAGCTTTGCTTTAGAGCCGTCCGGTAC)
Site-directed mutagenesis
    nla28S-cyt H242AZS188F (CCTTCACTCGGCGCGTGGCGGCCGACCTCATCTCCCCGCTGG)
ZS188R (CCAGCGGGGAGATGAGGTCGGCCGCCACGCGCCGAGTGAAGG)
    nla28S-cyt D386AZS189F (GGCCGTGCTGGAGGTCGTGGCCAACGGCATCGGCATGGCGC)
ZS189R (GCGCCATGCCGATGCCGTTGGCCACGACCTCCAGCACGGCC)
    nla28 D53AZS192F (CCTTTGACCTGGTCCTCACGGCCATGGCCATGCCCGAGCCGG)
ZS192R (CCGGCTCGGGCATGGCCATGGCCGTGAGGACCAGGTCAAAGG)
qPCR
    nla28S (1,030 bp–1,209 bp of nla28S)ZS155F (CAGTTGTTGCAGGTGAGTGC)
ZS155R (GAAGGGCTGGAACAGTGAGG)
    rpoD (519 bp–687 bp of rpoD)ZS156F (CGCGGAAGAGAAGGAAGACG)
ZS156R (CTTCTCACCATCCTCGATGC)
  • a Primer sequences are presented in the 5′ to 3′ direction. Restriction endonuclease recognition sites are presented in italics. Mutated codons are presented in bold type.