Table 2

Primers used in this study

Type of analysis and primerSequence (5′–3′)
Construction of expression plasmid for PhoP expression in E. coli
    SCPhoPEX_FAATGGATCCGTGCTCGTCGTCGAGGACGA
    SCPhoPEX_RAATGAATTCTACGGCTCGAACTTGTAAC
DNase I footprinting assay
    SCamtBFP(M13F)GTAAAACGACGGCCAGTCCATGCCAGGTCATTCGGAG
    SCamtBFP(M13R)CAGGAAACAGCTATGACGGCGGAGCAGATGAGCATGA
    M13F-FAMGTAAAACGACGGCCAGT (5'-FAM labeled)
    M13R-FAMCAGGAAACAGCTATGAC (5'-FAM labeled)
RT-PCR
    hrdB-FGAGTCCGTCTCTGTCATGGCG
    hrdB-RTCGTCCTCGTCGGACAGCACG
    amtB-FATCCTCGTCATCGGCAAGC
    amtB-RTTGAAGCCGAACCAGCCGAA
    egfp-FGAAGAAGATGGTGCGCTCCT
    egfp-RGATGTTGCCGTCCTCCTTGA
Introducing mutations in amtB promoter for egfp fusion
    For wild-type amtBP
        amtBP-1CGGGATCCAACCCGAGGAGAGCACCGTG
        amtBP-2GGGAATTCCATATGCGGCGTCTCCTCGTCGT
    For a3-b3 site mutation
        amtBP-3CGGCCGGGGCCGGTCGTCGT
        amtBP-4CCTGTCCACGCACGGTACGCACCGTGCCTTCGTCAC
    For a1-b1 site mutation
        amtBP-6GAAGGCACGGTGCGTGTTAC
        amtBP-7ACTGTGGCGGCAGGGTAACGAGGGGCTTCCACCGAA
    For a2-b2 site mutation
        amtBP-8TCGTTGTTTCGCCGCCGTGA
        amtBP-9GAAATCTCCACCAGGGTCGCGCTGCGTCAATGTCGT
Synthesizing mutants of amtB promoter by oligonucleotides for EMSA
    For the wild-type oWT
        oWTp1ACGACGACGACCGGCCCCGGCCGTTCACCCACGCGTAACACGCACCGTGCCTTC
        oWTp2CACGACATTGACGCAGCGCGGTTTCGGTGGAAGCCCCTCGTTGTTTCGCCGCCGTGACGAAGGCACGGTGCGT
    For oM3, mutagenesis at a3-b3 site
        oM3p1ACGACGACGACCGGCCCCGGCCGCCTGTCCACGCACGGTACGCACCGTGCCTTC
        oM3p2Same as oWTp2
    For oM1, mutagenesis at a1-b1 site
        oM1p1Same as oWTp1
        oM1p2CACGACATTGACGCAGCGCGGTTTCGGTGGAAGCCCCTCGTTAGGGTGCCGCCACAGTGAAGGCACGGTGCGT
    For oM2, mutagenesis at a2-b2 site
        oM2p1Same as oWTp1
        oM2p2CACGACATTGACGCAGCGCGACCCTGGTGGAGATTTCTCGTTGTTTCGCCGCCGTGACGAAGGCACGGTGCGT