Table 2

Primer pairs used for amplification and sequencing of specific genomic regionsa

Genomic region nameForward sequenceReverse sequenceLeft endRight end
crlCAGGAAATCACCGACTGGATCGACGTCGGTGCTACGTATT257733258407
oppA-ychEGGCATTGGGGATTGAATTTATCAGAACGCCAGCTGCTACTA12984051299250
glpRGAACTTTCTGCCAGCGTCACCCTGCTCTGGTGGTGGTATC35575293559014
ylbEAAAACGTCGCCGTGATTAACCAACCTGTGGTCGTTCATTG547429549078
ppiC-yifOCAGTGCTGCTGCTGTTTTTGTTGATCAGCAGATTCGTTGG39578133958210
gatCCGCACCTCATCCTGATGTTTCACTGCCAAAGTGGATCGTA21708122172421
  • a Shown are primer pairs used for amplification and sequencing of specific genomic regions, including the genomic locations of the leftmost and rightmost ends of the primers (using one-indexed genomic coordinates). The locations of all primers are shown in genomic context, along with the mutations that they are designed to test, in Note S1 in the supplemental material.