Table 2

Oligonucleotides used in this study

PrimerOligonucleotide sequence (5′ → 3′)a
HindIII-yufQ FCCCAAGCTTGTCCCTGCCACACTCG
BamHI-yufQ RCGCGGATCCGCTGACTGTCTGGTCG
HindIII-bcrC FCCCAAGCTTGTCGCCTATGCCCTTATCC
BamHI-bcrC RCGCGGATCCCAAAAATGACAAGCGGC
yubB-FCGGTTGCCAAAGTCATTACG
yubB-RGCCTTAAGAAGAAACGGACG
pHASH120-uppSFATGCTCAACATACTCAAAAATTGGAAG
pHASH120-uppSRGATCATTCCGTCGTTTTGCG
pHASH120-yubBFATGACTCTATGGGAATTGTTTGTAGC
pHASH120-yubBRGTGTCTGTCGCTGTTTTCCG
RT-qPCR 16S-FATCTTCCGCAATGGACGA
RT-qPCR 16S-RGCCGTGGCTTTCTGGTTA
RT-qPCR uppS-FCAAACTGCGGCTTCCAAC
RT-qPCR uppS-RCGGCCATTTCCATCCATG
RT-qPCR bcrC-FATACGCAGGCATCACAGG
RT-qPCR bcrC-RCACCTGTCGTATGGTCAC
RT-qPCR yubB-FAAATTGCCGTCGGACTCG
RT-qPCR yubB-RGACCCAGTCAGCAAAAAGC
  • a HindIII and BamHI restriction sites are underlined.