Table 2

Primers used in this study

NameSequence (5′→ 3′)aAnnealing position
CSPB-AATAGGATCCGATCGCTCACCGCGAGACForward primer, anneals 356 bp upstream from cspB translation start site
CSPB-BGAAAAGCTTCAAGGCCTCACGCTGCGCReverse primer, anneals 487 bp downstream from cspB translation start site
CSPB-CAAAAAGCTTGAACCACTTTACGGTGCCGReverse primer, anneals 26 bp downstream from cspB translation start site
CSPB-DAAAAAGCTTCCGGGCAGTTGACCGCAGCGForward primer, anneals 187 bp downstream from cspB translation start site
CSPB-EAAAGGTACCGAATCTGGCAGGTGTGGCCReverse primer, anneals 992 bp downstream from cspB translation start site
CSPB-FGGATCCGCTCATTGCCGATGCTGGForward primer, anneals 734 bp upstream from cspB translation start site
CSPB-R1AGGATCCCCTGAAAATAAAACAATTGTGGForward primer, anneals 187 bp upstream from cspB translation start site
CSPB-R2AAAGCTTCATGTTTGTATCTTTCAGATGTGReverse primer, anneals 3 bp downstream from cspB translation start site
CSPB-R3AAAGCTTCATGTTTGTATCTTTCAGATAAGAGCAAGCGTGGAGAGCGACReverse primer, anneals 93 bp upstream from cspB translation start site containing the region −17 to +3
CSPB-R4ATAAAGCTTCTCGTAGTTGAGCTTCTGACCReverse primer, anneals 152 bp downstream from cspB translation start site
CSPA-ACGAAACGGCTCGAGCGATGReverse primer, anneals 330 bp downstream from cspA translation start site
CSPA-BATAGGATCCGTCGTTCTCAGAACCATCForward primer, anneals 380 bp upstream from cspA translation start site
CSPA-R2AAAGCTTCATGGGGATGTTCCTTGTAGGReverse primer, anneals 3 bp downstream from cspA translation start site
CSPA-R3AAAGCTTCATGGGGATGTTCCTTGTAGCTCCTGGTCCAGGAGCAAGGReverse primer, anneals 90 bp upstream from cspA translation start site containing the region −15 to +3
CSPA-R4TTTAAGCTTGACTTCGGGCTCGTACGAGATCReverse primer, anneals 162 bp downstream from cspA translation start site
CSPA-R5AGGATCCACGGTATTTCTCTTGATATCCCCForward primer, anneals 196 bp upstream from cspA translation start site
CSPA-R8TTTAAGCTTATTCGATACAACCATAAACAGGReverse primer, anneals 133 bp upstream from cspA translation start site
RicLacFowGTTTTACAACGTCGTGACTGGForward primer, anneals 31 bp downstream from lacZ translation start site
RicLacRevGATGGGCGCATCGTAACCReverse primer, anneals 300 bp downstream from lacZ translation start site
  • a Boldface letters indicate restriction enzyme recognition sites, used for cloning purposes.