TABLE 3

Primers used in this study

Primer application and nameaPrimer sequence (5′→3′)b
Cloning
    LpxJ_to_pFLAG.FwATATCATATGAAGCTTATGCGAAAAGCTCTTAAAAAATTTTTAAAAAATAGTAAATGCT
    LpxJ_to_pFLAG.RvCCCGGGAATTCTCGACCTTTCTTTAAGCTCTCTGTTAAGCTTTTTAATTGT
SDM
    SiteMut_H61toA_topGGTGTAATCTTTGCATTTTGGGCTAATATGCTTGCCTTAAGTCCC
    SiteMut_H61toA_bottomGGGACTTAAGGCAAGCATATTAGCCCAAAATGCAAAGATTACACC
    SiteMut_H84toA_topATCTATGCTTTAATATCACCAGCTTTAGATGGTAAAATTTTAAAC
    SiteMut_H84toA_bottomGTTTAAAATTTTACCATCTAAAGCTGGTGATATTAAAGCATAGAT
    SiteMut_D86toA_topTATCTATGCTTTAATATCACCACATTTAGCTGGTAAAATTTTAAACGCCATAGTAGGGA
    SiteMut_D86toA_bottomTCCCTACTATGGCGTTTAAAATTTTACCAGCTAAATGTGGTGATATTAAAGCATAGATA
    SiteMut_D132toA_topCAAGGTGCAAATATAATAGTTACACCGGCTGGTCCTAAAGGACCTGTATATAAAGTAAA
    SiteMut_D132toA_bottomTTTACTTTATATACAGGTCCTTTAGGACCAGCCGGTGTAACTATTATATTTGCACCTTG
    SiteMut_D173toA_topCTTCTAGGTATTTCAGATTAAAAAGTTGGGCTAAATTAATAATACCAATACCGTTTGGT
    SiteMut_D173toA_bottomACCAAACGGTATTGGTATTATTAATTTAGCCCAACTTTTTAATCTGAAATACCTAGAAG
    SiteMut_W60toA_topAAATGAACAAGGTGTAATCTTTGCATTTGCGCATAATATGCTTGCCTTAAGTCCCGTTA
    SiteMut_W60toA_bottomATAACGGGACTTAAGGCAAGCATATTATGCGCAAATGCAAAGATTACACCTTGTTCATTT
    SiteMut_W172toA_topTACTTCTAGGTATTTCAGATTAAAAAGTGCGGATAAATTAATAATACCAATACCGTTTG
  • a SDM, site-directed mutagenesis.

  • b Boldface letters represent nucleotides changed in site-directed mutagenesis.