TABLE 1

Strains, plasmids, and oligonucleotides

Strain, plasmid, or oligonucleotideRelevant characteristic(s)aSource or reference
Strains
    RN4220Highly transformable S. aureus52
    AH1263USA300 CA-MRSA strain LAC without LAC-p0353
    JLB2AH1263 ΔfakA27
    JLB113AH1263 ccpA::tetL12
    JLB114AH1263 ΔfakA ccpA::tetLThis study
    JLB127AH1263 ackA::ΝΣThis study
    JLB128AH1263 ΔfakA ackA::ΝΣThis study
    JLB132AH1263 ureB::ΝΣThis study
    JLB133AH1263 ΔfakA ureB::ΝΣThis study
    JLB158AH1263 gudB::ΝΣThis study
    JLB159AH1263 ΔfakA gudB::ΝΣThis study
    NE385Source of acsA::ΝΣ54
    NE1397Source of alsS::ΝΣ54
    NE1642Source of ureB::ΝΣ54
    KB8007JE2-ΔackA::ermB; Emr33
    JLB165AH1263 codY::ΝΣThis study
    JLB166AH1263 ΔfakA codY::ΝΣThis study
    NE1518Source of gudB::ΝΣ54
    NE1555Source of codY::ΝΣ54
    NE1670Source of ccpA::ΝΣ54
    NE1923Source of ldh1::ΝΣ54
    NE1816Source of ldh2::ΝΣ54
    JLB115AH1263 saeR::ΝΣ30
    JLB116AH1263 ΔfakA saeR::ΝΣ30
    JLB115AH1263 acsA::ΝΣThis study
    JLB116AH1263 ΔfakA acsA::ΝΣThis study
    JLB188AH1263 ldh1::ΝΣThis study
    JLB189AH1263 ΔfakA ldh1::ΝΣThis study
    JLB196AH1263 ldh2::ΝΣThis study
    JLB197AH1263 ΔfakA ldh2::ΝΣThis study
    JLB135AH1263 alsS::ΝΣThis study
    JLB136AH1263 ΔfakA alsS::ΝΣThis study
Plasmids
    pJB185Promoterless codon-optimized lacZ, Amp/Cmr30
    pJB165fakA complement, Amp/Cmr27
    pZD3Pure-lacZ reporter, Amp/CmrThis study
Oligonucleotides
    RT_ilvD_FGGACCAGGTATGCCTGAAATThis study
    RT_ilvD_RGGGGAAATATGACCAACTGCThis study
    RT_gltA_FTGGAAAAACGTATGGCAGAAThis study
    RT_gltA_RCCATCCTGCAGAACGACTTAThis study
    RT-sigA-FAACTGAATCCAAGTGATCTTAGTG55
    RT-sigA-RTCATCACCTTGTTCAATACGTTTG55
    Purease-F2aatgaattcGATGATGCTACCTACAATAGCCGCTAThis study
    Purease-R2ggacgtcgacCCAATTTCATATTAGATACAATTTACAAAATTThis study
    CNK61GATATGCCATTTCCAACTGTCGThis study
    CNK63GCTGCAAGTTGATCCATAGAGGThis study
  • a Antibiotic resistance abbreviations used: Amp/Cmr, ampicillin and chloramphenicol resistant; Emr, erythromycin resistant; tetL, tetracycline resistance gene. Oligonucleotide sequences are provided in the 5′-to-3′ orientation. Lowercase indicates nonhomologous sequences added for cloning purposes. CA-MRSA, community-associated methicillin-resistant Staphylococcus aureus.