Table 1

Oligonucleotide primers used in this studya

PrimerSequence (5′–3′)Note
P1TTGCATCAATACTGGACTCInactivation, flgJBb, F
P2TTGAATTTTCAGATCCCTCInactivation, flgJBb, R
P3AAGCTTTAATACCCGAGCTTCAAGkan cassette, F
P4AAGCTTTCAAGTCAGCGTAATGCTkan cassette, R
P5TATCAGAGGTAGTTGGCGTCaadA cassette, F
P6TGTCTAGCTTCAAGTATGACGaadA cassette, R
P7CATATGGAAACCAAAATTAATTCACComplementation, F
P8CTGCAGTTATTTACTTTTTTGTAATTGComplementation, R
P9GGATCCTAATACCCGAGCTTCAAGComplementation, PflgB, F
P10CATATGACCTCCCTCATTTAAAATTGCComplementation, PflgB, R
P11ACCCAATATCCTAAAACTTCRT-PCR, bb0776, F
P12TGGCAGCTGTATAAATTCCTRT-PCR, bb0775, R
P13ACATCTGGCAAAGCACAAGART-PCR, bb0775, F
P14GTATTGTTGTGCAGTCATTCRT-PCR, bb0774, R
P15ACTCAAAAGCTATTCAAACTRT-PCR, bb0774, F
P16TGAATTGTTGCTTTTTACCTRT-PCR, bb0773, R
P17CACAACAAGAATAAATGATGRT-PCR, bb0773, F
P18GTTGAAGCTTTGTTTGTTTGRT-PCR, bb0772, R
P19TGGAGGAAATTGATGGAAACRT-PCR, bb0772, F
P20TTAAATCGGCAAGGCCAAAGRT-PCR, bb0858, R
P21GCCTTGCCGATTTAATTTACRT-PCR, bb0858, F
P22TAGCTTGTGTTCTCTTACTGRT-PCR, bb0771, R
P23TCATCTGCTATGATTATGCCACCqRT-PCR, flaA, F
P24AGAATAAGCATATTCCATGCCATqRT-PCR, flaA, R
P25CATATTCAGATGCAGACAGAGGqRT-PCR, flaB, F
P26CCCTGAAAGTGATGCTGGTGTGqRT-PCR, flaB, R
P27TTCTCGCCCTACTGATGCTCqRT-PCR, flgE, F
P28CCGTTGCCACTAACTCCAAGqRT-PCR, flgE, R
P29AACAGGAATTAACGAGGCTGqRT-PCR, eno, F
P30AAATTGCATTAGCACCAAGCqRT-PCR, eno, R
P31CACCATGGAAACCAAAATTAATTCACrFlgJBb, F
P32TTTACTTTTTTGTAATTGrFlgJBb, R
  • a The underlined sequences are engineered restriction cut sites for DNA cloning. F, forward; R, reverse.