TABLE 1

Bacterial strains, plasmids, and oligonucleotides used in this work

Strain, plasmid, or oligonucleotideRelevant characteristics or sequence (5′–3′)aReference or source
Strains
    E. coli
        JM103hsdR4 Δ(lac-pro) F′ traD36 proAB lacIq lacZΔM1534
        BL21(DE3)/pLysSF ompT hsdSB (rB mB) gal dcm (DE3)/pLysS CmrNovagen
        M15/pREP4thi lac gal mlt F′/pREP4 KanrQiagen
        S17-1recA endA thi hsdR RP4-2-Tc::Mu-Kan::Tn7 Tpr Smr35
    R. sphaeroides
        WS8NWild type; spontaneous Nalr45
        sltF1WS8N derivative ΔsltF(1–336)::aadA Fla Spcr Nalr20
        sltFΔ47WS8N derivative ΔsltF/pRK415 ΔsltF(510–651) Spcr Nalr TcrThis study
        sltFΔ95WS8N derivative ΔsltF/pRK415 ΔsltF(510–795) Spcr Nalr TcrThis study
        sltFΔ17WS8N derivative ΔsltF/pRK415 ΔsltF(27–78) Spcr Nalr TcrThis study
Plasmids
    pGT0011.4-kb PstI fragment containing sltF wild type cloned into pTZ19R; Ampr19
    pQE60Expression vector; 6×His C-terminal AmprQiagen
    pQE30Expression vector; 6×His N-terminal AmprQiagen
    pRK415pRK404 derivative, for expression on R. sphaeroides, lacZ mob+ Tcr46
    pRK415/SltFsltF wild type cloned into EcoRI/HindIII sites of pRK415; Tcr20
    pRK415/SltFΔ47ΔsltF(510–651) cloned into EcoRI/HindIII sites of pRK415; TcrThis study
    pRK415/SltFΔ95ΔsltF(510–795) cloned into EcoRI/HindIII sites of pRK415; TcrThis study
    pRK415/SltFΔ17ΔsltF(27–78) cloned into EcoRI/HindIII sites of pRK415; TcrThis study
    pQE30/SltF Sec-sltF cloned into SacI/HindIII sites of pQE30; Ampr20
    pQE30/SltFΔ95Sec-ΔsltF(510–795) cloned into SacI/HindIII sites of pQE30; AmprThis study
    pQE30/SltFΔ47Sec-ΔsltF(510–651) cloned into SacI/HindIII sites of pQE30; AmprThis study
    pRSJflgJ cloned into NcoI/BglII sites of pQE60; Ampr20
Oligonucleotides
    Mur/sec/NH2CATGGAGCTCGCGGACGAGGGCTGCGAGACG20
    Mur/sec/COH2CCCGAAGCTTTCACGGTTGCATTGCGAGCAG20
    MurNH2pQE60CATGCCATGGCGGACGAGGGCTGCGAGACG20
    FwΔ17CCCCGCCCTCGCGGCGGACGAGGGGCTGATGGAGGCGATThis study
    RvΔ17ATCGCCTCCATCAGCCCCTCGTCCGCCGCGAGGGCGGGGGThis study
    FwΔ47TCGCCAAGGTCGAGGCCGAGGCGGCCTCCGACATTCCCTCThis study
    RvΔ47GAGGGAATGTCGGAGGCCGCCTCGGCCTCGACCTTGGCGAThis study
    FwΔ95(1558)CTTTCGATGCCGCCGTGAGCThis study
    RvΔ95CCCGAAGCTTTCACTCGGCCTCGACCTTGGCCThis study
    RvΔ95HisCCTGAGATCTCTCGGCCTCGACCTTGGCThis study
  • a Cmr, chloramphenicol resistance; Kanr, kanamycin resistance; Tpr, trimethoprim resistance; Smr, streptomycin resistance; Spcr, spectinomycin resistance; Nalr, nalidixic acid resistance; Tcr, tetracycline resistance; Ampr, ampicillin resistance.