TABLE 3

Oligonucleotide sequences and descriptions

Oligonucleotide nameSequenceaDescription
ΔrecJ-P1GGTTCGTCGTCAATCCTGAAPrimer to interrupt Nm8013 recJ by replacing recJ with kan
ΔrecJ-P2GCAGGTCGACTCTAGAGGATCAACGTGGAACTTTACAGTGCGGGTPrimer to interrupt Nm8013 recJ by replacing recJ with kan
ΔrecJ-P3(Kan)ACCCGCACTGTAAAGTTCCACGTTGATCCTCTAGAGTCGACCTGCPrimer to interrupt Nm8013 recJ by replacing recJ with kan
ΔrecJ-P4(Kan)CGCTTCCCAGTAGTCGATATAAAGTCAGAAGAACTCGTCAAGAAGGCGPrimer to interrupt Nm8013 recJ by replacing recJ with kan
ΔrecJ-P5CGCCTTCTTGACGAGTTCTTCTGACTTTATATCGACTACTGGGAAGCGPrimer to interrupt Nm8013 recJ by replacing recJ with kan
ΔrecJ-P6CCGACCACATAAGCCTGAAAPrimer to interrupt Nm8013 recJ by replacing recJ with kan
Δrep-P1CCGTGTTCGGACGGTTATTAPrimer to interrupt Nm8013 rep by replacing recJ with kan
Δrep-P2GCAGGTCGACTCTAGAGGATCGTTTTGATGCCGTCTGAAATCPrimer to interrupt Nm8013 rep by replacing recJ with kan
Δrep-P3(Kan)GATTTCAGACGGCATCAAAACGATCCTCTAGAGTCGACCTGCPrimer to interrupt Nm8013 rep by replacing recJ with kan
Δrep-P4(Kan)CATTGCGGCTCCGGTTTAATCTCAGAAGAACTCGTCAAGAAGGCGPrimer to interrupt Nm8013 rep by replacing recJ with kan
Δrep-P5CGCCTTCTTGACGAGTTCTTCTGAGATTAAACCGGAGCCGCAATGPrimer to interrupt Nm8013 rep by replacing recJ with kan
Δrep-P6CGGCGAACTCTTAAACCATTTCPrimer to interrupt Nm8013 rep by replacing recJ with kan
ΔrecQ-P1GGGACAATTGGAACGCTTTGForward primer to amplify the recQ::erm region from the FA1090 recQ mutant
ΔrecQ-P2GCAACACCCAATCGTTCAAGReverse primer to amplify the recQ::erm region from the FA1090 recQ mutant
ΔrecJ-colony PCR1ACCCGCACTGTAAAGTTCCACGTTForward primer to verify recJ interruption
ΔrecJ-colony PCR2CGCTTCCCAGTAGTCGATATAAAGReverse primer to verify recJ interruption
Δrep-colony PCR1GATTTCAGACGGCATCAAAACForward primer to verify rep interruption
Δrep-colony PCR2CATTGCGGCTCCGGTTTAATCReverse primer to verify rep interruption
454-8013-P1CCATCTCATCCCTGCGTGTCTCCGACTCAGACGAGTGCGTTCGCCCTTCCTGCTTATCAAForward primer to amplify the pilE region for 454 sequencing, with MID for Nm8013 parent strain grown on solid medium for 11 h
454-P2CCTATCCCCTGTGTGCCTTGGCAGTCTCAGCGTGGAAAATCACTTACCGCReverse primer to amplify the pilE region for 454 sequencing
454-recA-P1CCATCTCATCCCTGCGTGTCTCCGACTCAGAGTATACATATCGCCCTTCCTGCTTATCAAForward primer to amplify the pilE region for 454 sequencing, with MID for Nm8013 recA mutant grown on solid medium for 15 h
454-recX-P1CCATCTCATCCCTGCGTGTCTCCGACTCAGCGTCTAGTACTCGCCCTTCCTGCTTATCAAForward primer to amplify the pilE region for 454 sequencing, with MID for Nm8013 recX mutant grown on solid medium for 13 h
454-recQ-P1CCATCTCATCCCTGCGTGTCTCCGACTCAGAGCACTGTAGTCGCCCTTCCTGCTTATCAAForward primer to amplify the pilE region for 454 sequencing, with MID for Nm8013 recQ mutant grown on solid medium for 11 h
454-recJ-P1CCATCTCATCCCTGCGTGTCTCCGACTCAGTGTACTACTCTCGCCCTTCCTGCTTATCAAForward primer to amplify the pilE region for 454 sequencing, with MID for Nm8013 recJ mutant grown on solid medium for 13 h
454-rep-P1CCATCTCATCCCTGCGTGTCTCCGACTCAGTACGAGTATGTCGCCCTTCCTGCTTATCAAForward primer to amplify the pilE region for 454 sequencing, with MID for Nm8013 rep mutant grown on solid medium for 15 h
454-8013-P1-17hCCATCTCATCCCTGCGTGTCTCCGACTCAGACGACAGCTCTCGCCCTTCCTGCTTATCAAForward primer to amplify the pilE region for 454 sequencing, with MID for Nm8013 parent strain grown on solid media for 17 h
454-recA-P1-21hCCATCTCATCCCTGCGTGTCTCCGACTCAGTAGCTCTATCTCGCCCTTCCTGCTTATCAAForward primer to amplify the pilE region for 454 sequencing, with MID for Nm8013 recA mutant grown on solid medium for 21 h
454-recX-P1-21hCCATCTCATCCCTGCGTGTCTCCGACTCAGACTCATCTACTCGCCCTTCCTGCTTATCAAForward primer to amplify the pilE region for 454 sequencing, with MID for Nm8013 recX mutant grown on solid medium for 21 h
454-recQ-P1-21hCCATCTCATCCCTGCGTGTCTCCGACTCAGTGATGTGTACTCGCCCTTCCTGCTTATCAAForward primer to amplify the pilE region for 454 sequencing, with MID for Nm8013 recQ mutant grown on solid medium for 21 h
454-recJ-P1-21hCCATCTCATCCCTGCGTGTCTCCGACTCAGAGAGCGTCACTCGCCCTTCCTGCTTATCAAForward primer to amplify the pilE region for 454 sequencing, with MID for Nm8013 recJ mutant grown on solid medium for 21 h
454-rep-P1-17hCCATCTCATCCCTGCGTGTCTCCGACTCAGAGCGACTAGCTCGCCCTTCCTGCTTATCAAForward primer to amplify the pilE region for 454 sequencing, with MID for Nm8013 rep mutant grown on solid medium for 17 h
  • a The MID for each sample is underlined.