Table 1

List of oligonucleotides used for the construction and manipulation of plasmids in this study

NameSequence (5′ to 3′)aPurpose
espACD-FwdCAGAAGCTTCCATCGTCGGTTTTCGTCPCR and construction of pMDespACD for ectopic expression of EspA, EspC, and EspD in M. tuberculosis
espACD-RevCGCCTGCAGATTAATGCTGAGCCGCGAATPCR and construction of pMDespACD for ectopic expression of EspA, EspC, and EspD in M. tuberculosis
espA-FwdCAGAAGCTTCGGTTTTCGTCGCCTTATCAPCR and construction of pMDespA for ectopic expression of EspA only in M. tuberculosis
espA-RevCGCCTGCAGCGCTGGCTAGCAATGGATTTPCR and construction of pMDespA for ectopic expression of EspA only in M. tuberculosis
espD-FwdGCAGAATTCGTGGACTTGCCCGGAAATGACTTTPCR and construction of pMVespD for ectopic expression of EspD only in M. tuberculosis
espD-RevCGCAAGCTTTCACCATGGATCGCTCTCGTCGTCTGGPCR and construction of pMVespD for ectopic expression of EspD only in M. tuberculosis
espDstopATTCCGAAGGGACGGTGGACTTGCCCTGAAATGACTTTGACAGCAACGATTTCGAInsertion of a stop codon (in bold italics) in espD of pMDespACD to generate pMDespACDstop
espCFLAGGCGCAATGCTAAACGGAAGGGACACGATCAATGGACTACAAGGACGATGACGACAAGGGAATGACGGAAAACTTGACCGTCCAGCCCGAGInsertion of an amino-terminal FLAG epitope (underlined and italic) in espC of pMDespACD and pMDespACDstop to generate pMDespACFLAGD and pMDespACFLAGDstop
EspD_W19RCCGTGGATCTCCGGGGTGCCGACGGSite-specific mutagenesis and truncations in EspD for codon replacements (in bold italics) in espD of pMDespACD
EspD_W27RGCGCGGAGGGCCGGACTGCGGATCCSite-specific mutagenesis and truncations in EspD for codon replacements (in bold italics) in espD of pMDespACD
EspD_P31AGGACTGCGGATGCGATTATTGGCGTSite-specific mutagenesis and truncations in EspD for codon replacements (in bold italics) in espD of pMDespACD
EspD_R138ACAGATGAACACGCCGTCGCACTGCTSite-specific mutagenesis and truncations in EspD for codon replacements (in bold italics) in espD of pMDespACD
EspD_W150RTGGGCGAAACCCGGGGGTTACCATCSite-specific mutagenesis and truncations in EspD for codon replacements (in bold italics) in espD of pMDespACD
EspD_Δ30CTGGTTACCATCGTAGGAAGAAGCCGCSite-specific mutagenesis and truncations in EspD for codon replacements (in bold italics) in espD of pMDespACD
EspD_Δ16CTTGTTCGCGACGTGATACAGCGACGASite-specific mutagenesis and truncations in EspD for codon replacements (in bold italics) in espD of pMDespACD
EspD_Δ8CTATTGTCCAGCATAAGACGACGAGAGSite-specific mutagenesis and truncations in EspD for codon replacements (in bold italics) in espD of pMDespACD
  • a Modified codons are in bold italics, the FLAG sequence is underlined and italicized, and restriction sites are in italics without boldface or underlining.