TABLE 2

Primers used in this study

Gene targetPrimer nameSequence (5′ to 3′)Reference or source
prgBprgB_FGCCAACAGAAGTTGCACCAGThis study
prgB_RCGCATGGCCACCTTTATTCGThis study
ebpCebpC_FCGGTCATACCGACGACCAAAThis study
ebpC_RTGTCACATCGCCATCGACTTThis study
gyrAgyrA_FTGTTCGTCGGGATGTGAGTG10
gyrA_RGGTACGCCTTTTTCGATGGC10
ebpRebpR_FGGCAAAAACGTCAACGACCAThis study
ebpR_RTCGAGCAAAAGAAGAGCGACTThis study